ID: 1172937517

View in Genome Browser
Species Human (GRCh38)
Location 20:38630924-38630946
Sequence CTTAGGTAACATTTTACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172937514_1172937517 3 Left 1172937514 20:38630898-38630920 CCACGTGATGATGCAGTCGATGC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1172937517 20:38630924-38630946 CTTAGGTAACATTTTACTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172937517 Original CRISPR CTTAGGTAACATTTTACTGA GGG Intronic
900554955 1:3275723-3275745 TTTAGGTGACCTTTTGCTGAGGG + Intronic
902577263 1:17386283-17386305 CATAGCTAACATTTCACTGTGGG - Intronic
902602290 1:17548344-17548366 CTTACGTAACATTTTAACAAAGG + Intronic
904543573 1:31250554-31250576 GTTAGGAAAAGTTTTACTGAGGG - Intergenic
904919073 1:33992562-33992584 GTTATCTAACATTTTATTGATGG - Intronic
906335589 1:44927314-44927336 CTCAGGGAACTTTTTACTCATGG + Intronic
908020737 1:59895852-59895874 ATTAGTTAACACTTTACTAAGGG + Intronic
908704162 1:66931978-66932000 CTAAGGCAAGATATTACTGAAGG + Intronic
910702907 1:90095635-90095657 CTTAAAAAACATTTAACTGAGGG - Intergenic
911236586 1:95418746-95418768 CTGAGGATACATTTCACTGAAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915990456 1:160510618-160510640 CACAGCTAACATTTTACTCAAGG + Intronic
918503482 1:185225027-185225049 CATAGTTAACATCATACTGAAGG - Intronic
918706350 1:187667682-187667704 TTTCGGCATCATTTTACTGAAGG - Intergenic
922634574 1:227154342-227154364 CCTATTTAACATTGTACTGAAGG + Intronic
1063793249 10:9479670-9479692 CTGATGAGACATTTTACTGATGG + Intergenic
1063861184 10:10309297-10309319 CTTGGCTCACATTTTAATGAAGG + Intergenic
1068363206 10:56008234-56008256 CTTAGGAAACATATTGCTGATGG + Intergenic
1068855103 10:61789514-61789536 TTTTGATAGCATTTTACTGATGG - Intergenic
1069315858 10:67101017-67101039 GTTAGCTAATATTTTACAGATGG - Intronic
1074200711 10:111232541-111232563 CTTAGGCGACATTTCACTGCAGG - Intergenic
1074899548 10:117804366-117804388 CCTAGGTTCCATTTTACAGATGG + Intergenic
1075234665 10:120716077-120716099 ATAAGGGAACATTTCACTGAGGG - Intergenic
1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG + Intergenic
1076110740 10:127857191-127857213 CATAGGTAACATGGCACTGAAGG + Intergenic
1079662913 11:23064103-23064125 CTAAGGTGACATTTTACAAAAGG + Intergenic
1081112539 11:39153860-39153882 CCTAGGAAACATTTTATAGATGG + Intergenic
1082108764 11:48248876-48248898 CTTAGGTAGTCTTCTACTGATGG + Intergenic
1082687184 11:56254616-56254638 GTTAGGTAACGTTTTAGTCAAGG + Intergenic
1082748205 11:56990815-56990837 AGAAGGTAACATTTTATTGAAGG - Intergenic
1083430156 11:62610141-62610163 CTTTGGTCCCATTTTACGGATGG - Intronic
1084266406 11:68007654-68007676 CTTATGTCCCATTTTACAGATGG + Intergenic
1086436099 11:86782373-86782395 TTTAAGAAACATTTTACTAAGGG + Intergenic
1086773305 11:90796404-90796426 TTTAGGTACCATTTAGCTGATGG + Intergenic
1087142554 11:94779319-94779341 CTTATGTAACATTTTCTTGACGG + Intronic
1087521625 11:99245160-99245182 CTTAGGTATATTTTTACTGATGG + Intronic
1087870091 11:103283203-103283225 CTTTGGTAACTTTTTACTGGGGG - Intronic
1089380684 11:118029157-118029179 CTTGAGTAACATTTTATTGTAGG - Intergenic
1090149011 11:124361602-124361624 CTTTTGACACATTTTACTGAAGG + Intergenic
1090869530 11:130731014-130731036 CTTAAGGAACATGATACTGAGGG + Intergenic
1091659251 12:2370998-2371020 CTTATGTAACAGTTTCCAGATGG - Intronic
1093634578 12:21449687-21449709 CTCAGGTAACATTTTAAGGTTGG + Exonic
1094210127 12:27881006-27881028 CATAGTTAACATTATACTCATGG - Intergenic
1094255504 12:28420884-28420906 CTTAAATAACTTTTTACTGGTGG + Intronic
1094458430 12:30665728-30665750 CCTAGCTGAGATTTTACTGAAGG - Exonic
1094590300 12:31813379-31813401 CAAAGGCAAGATTTTACTGAAGG - Intergenic
1096208606 12:49744508-49744530 CTTAGGTAACCTTTAAGTCAAGG - Intronic
1099427477 12:82541189-82541211 TTTAGTTTGCATTTTACTGATGG + Intergenic
1099940738 12:89185105-89185127 CTTTGAAAACATTTTAGTGATGG - Intergenic
1101142122 12:101807026-101807048 ATTTGATAATATTTTACTGAGGG - Intronic
1103637419 12:122318993-122319015 CTAAGGTGACTGTTTACTGATGG - Intronic
1104473735 12:129053122-129053144 CTTAGCTAGCTTTCTACTGAAGG + Intergenic
1105657920 13:22460340-22460362 CTTAGGTAAAAAATTAATGAAGG - Intergenic
1106778424 13:33031159-33031181 CTTAGGAAACATGACACTGAAGG - Intronic
1107919102 13:45184721-45184743 GTTAGGAAAGATTTTACTTAGGG + Intronic
1108991981 13:56670967-56670989 CTTGGGTCACACTTTACTTATGG - Intergenic
1109549165 13:63870505-63870527 CTTAGGGAATATTTTACACATGG - Intergenic
1110795613 13:79633929-79633951 AATAAATAACATTTTACTGAAGG + Intergenic
1114311678 14:21473364-21473386 CTAAGGTATTATTTTACTTAGGG + Intronic
1115845974 14:37534950-37534972 CTTTGGTATAATTTTACTCAAGG - Intronic
1116157794 14:41230656-41230678 CTTTGTTAACATTTTCCTGCTGG + Intergenic
1117809547 14:59532230-59532252 TTTTGGTAAAATATTACTGAAGG - Intronic
1117814631 14:59584073-59584095 CTAAGGTAACATTTTATGGTAGG + Intergenic
1117980208 14:61335277-61335299 TTTAGAAAACATGTTACTGAAGG - Intronic
1121237055 14:92399485-92399507 CTTAGGTAACATCTTGCATATGG - Intronic
1122136733 14:99637680-99637702 CTCAGGGAACATTCTCCTGAAGG - Intergenic
1122170049 14:99865449-99865471 CAAAGGTAACATTTTACAGCAGG - Intronic
1125116424 15:36097778-36097800 CTTAGTTCACATTTTGCTTAGGG + Intergenic
1126806630 15:52356535-52356557 CTTAGCTATTATTTTACTGATGG + Intronic
1128378646 15:67094992-67095014 GACAGGTAACATTTTACTGCTGG - Intronic
1131940663 15:97561603-97561625 CTTAGGCAAAATGATACTGAGGG - Intergenic
1132389902 15:101430853-101430875 CTTATGAACCATTTTACAGACGG + Intronic
1135098503 16:19585231-19585253 CTTAGGTAAAATTTTAGGAATGG + Intronic
1139121814 16:64028080-64028102 AATAGGTAACATAATACTGAAGG - Intergenic
1140590708 16:76348925-76348947 CTGATGTAACAGTGTACTGATGG + Intronic
1141305922 16:82864230-82864252 CTTAGGAGACATTTTCATGAAGG + Intronic
1142817393 17:2437314-2437336 CTTGGGGATCATTTTAATGAAGG - Intronic
1144837700 17:18165778-18165800 CTTTAGTAAGATTTTACTGCAGG + Intronic
1149507659 17:57208385-57208407 CCTATCTAACATTTTATTGAAGG + Intergenic
1151630121 17:75305074-75305096 CTTTGGGAACATTTTCCTTATGG - Intergenic
1152209709 17:78996553-78996575 CTTTGGTTTCATGTTACTGAAGG - Intronic
1153516841 18:5911660-5911682 CTTAGGCAACATTTTAAAGTAGG + Intergenic
1155574819 18:27232838-27232860 CTTTGGTTATATTTTAATGAAGG + Intergenic
1155831370 18:30518920-30518942 TTTGAGTAACATTTTGCTGATGG + Intergenic
1156877047 18:42027240-42027262 CTTAGTTTACCTTTTATTGATGG + Intronic
1157374841 18:47152841-47152863 CATAAGAAACATTTTACTTAAGG + Intronic
1157895930 18:51467362-51467384 TTTAAGAAACATTTTACTGCTGG - Intergenic
1167297418 19:48659790-48659812 ATTATGTAACATTTTATTGGTGG + Intergenic
925400780 2:3570782-3570804 CTTAGAGAACATTTAACTAATGG + Intergenic
925505550 2:4559195-4559217 CTTCAGTAACATTTTTCTTATGG + Intergenic
926067020 2:9849878-9849900 CTTAGGTAAAGTCTAACTGATGG + Intronic
926529011 2:14018497-14018519 CTTAGCTAACATTTAGCTGTGGG + Intergenic
927205862 2:20609885-20609907 CTTAGCAAACGTTTCACTGATGG - Intronic
927581747 2:24256926-24256948 TTTAAGTAACTCTTTACTGAGGG - Intronic
930551842 2:52845296-52845318 TATAGGTAATATTTTACTGTAGG - Intergenic
931095856 2:58939984-58940006 AATAGGAAACTTTTTACTGAAGG + Intergenic
933351502 2:81158016-81158038 CTAAGGTAACTTTTTCCTGCGGG - Intergenic
935679779 2:105625916-105625938 TTTAGGTAACGTTTAACTCAAGG - Intergenic
935953969 2:108356272-108356294 CACAGGTAACATTATACTTATGG - Intergenic
938394575 2:130933644-130933666 CTTAGGAAACATTTTAACCAAGG - Intronic
939598195 2:144154246-144154268 CTTAGGAAAGCCTTTACTGATGG - Intronic
940917111 2:159268026-159268048 CTTAGTTAACATTGTATTTATGG - Intronic
942005916 2:171699328-171699350 ATTAGCTAATATTTTATTGAGGG + Intronic
942567198 2:177278870-177278892 ACTATGTAAAATTTTACTGAAGG - Intronic
942932346 2:181510518-181510540 ATTAGTGAACATTTTAATGAAGG - Intronic
943921846 2:193717254-193717276 ATTATGTAACATTTTATTTAAGG + Intergenic
944366406 2:198925307-198925329 GTTTGCTAACATTTTGCTGAGGG - Intergenic
945609789 2:211985499-211985521 CTTATGAACCCTTTTACTGATGG - Intronic
946386186 2:219385870-219385892 ATTAGGTCACATTTTACTCTTGG - Intronic
947138996 2:227003757-227003779 GTCATGTCACATTTTACTGAAGG + Exonic
1169650227 20:7858786-7858808 CTTAGGTTACAGTTTAATGATGG - Intergenic
1170132378 20:13034660-13034682 GTTGGGTTAAATTTTACTGAAGG - Intronic
1170288518 20:14740235-14740257 CTTATGAACCATTTTACAGATGG + Intronic
1170855146 20:20045695-20045717 CTTAGTTAAGATTTTAGTGGTGG + Intronic
1172497792 20:35401343-35401365 CTTGGGTGACATTTTAAAGATGG + Intronic
1172937517 20:38630924-38630946 CTTAGGTAACATTTTACTGAGGG + Intronic
1173774748 20:45695062-45695084 CTCAGGAAACACTTTACTTAAGG - Intronic
1174570831 20:51500183-51500205 TTCAGCTACCATTTTACTGAGGG - Intronic
1174570833 20:51500207-51500229 TTCATGTATCATTTTACTGAGGG - Intronic
1177041690 21:16120645-16120667 ATTAAGTAACATTTTCCAGAAGG - Intergenic
1182315980 22:29447648-29447670 CTTGGTAAACATTTTAATGATGG + Intergenic
1182974138 22:34606683-34606705 CTTAGGTAGAATTTTTGTGAGGG + Intergenic
1183306084 22:37083948-37083970 CTCTGGAAACATTTTATTGAAGG + Intronic
1183761513 22:39823874-39823896 TTTAAGTTACATTTTCCTGAAGG + Intronic
950757019 3:15182677-15182699 CTTAGGTAAAAGTTTATTGAAGG - Intergenic
952624524 3:35388205-35388227 ATTATGTAAAATTATACTGATGG - Intergenic
955721804 3:61890251-61890273 CTAAAGTAACAATTTAGTGAAGG + Intronic
955745314 3:62134709-62134731 CTTGGGTATCAGTTTCCTGAGGG + Intronic
956817149 3:72918135-72918157 TTCTGGTAACATTTTACTTATGG + Intronic
957000996 3:74884569-74884591 TTTAGCTAACATTTTCATGAAGG + Intergenic
958551118 3:95614437-95614459 CTTGGGGAATAATTTACTGAGGG - Intergenic
959140223 3:102477149-102477171 TTTAGATAACAGTTCACTGAGGG + Intronic
959983260 3:112542523-112542545 CCTAGGTTACATTTTACTTAGGG + Intronic
962237626 3:133720209-133720231 CATAGCTAACATCATACTGAAGG - Intergenic
962821397 3:139050677-139050699 CACAGCTAACATTATACTGAAGG - Intronic
962821930 3:139056899-139056921 ATTATTTAACATTGTACTGAAGG - Intronic
963117739 3:141746300-141746322 TTTAGGTAACATGTTAATGAGGG + Exonic
965239951 3:166182964-166182986 CTAAGGTAAAAATGTACTGAGGG - Intergenic
965388855 3:168080121-168080143 GTTGGGTAACATTTTAATAATGG + Intronic
967362711 3:188649880-188649902 CTTAGGTAAATTCTTCCTGAGGG + Intronic
968292886 3:197552646-197552668 CTTAGTAAACATTTTAGTAAAGG - Intronic
970140144 4:12973366-12973388 GTTGGGTCACATTTTATTGATGG + Intergenic
970232782 4:13928032-13928054 AATAGGTAGCATTTTACTGGGGG + Intergenic
970930225 4:21502601-21502623 CTTAGGCAAAATTTCACAGAAGG - Intronic
970937939 4:21596759-21596781 CCTAAGTAAGGTTTTACTGAGGG - Intronic
972413140 4:38813032-38813054 CCTATTTAACATTTTACTGGAGG - Intronic
973530790 4:51835148-51835170 CTTTGATAACATTTTACAGAGGG - Intergenic
976228048 4:82812357-82812379 CTTAGGCTACATTTGAGTGATGG - Intergenic
976338592 4:83919656-83919678 TTTATGTACCATTTTACTGGAGG - Intergenic
976835717 4:89370891-89370913 CTTAGGGAAGATATTACAGAAGG + Intergenic
978678389 4:111347489-111347511 CATAGCTAACATGATACTGAAGG - Intergenic
979103470 4:116653514-116653536 AGTTGTTAACATTTTACTGAAGG + Intergenic
979604750 4:122626053-122626075 CTTAAGGAAGATTTTACAGAAGG - Intergenic
982429271 4:155304269-155304291 CTTAGCTAAAATTTGACTGGAGG - Intergenic
982447770 4:155513895-155513917 CTTTGGTAATATTTTATTTAAGG + Intergenic
983861356 4:172711279-172711301 CTTAGGTGAGAGTTTTCTGATGG + Intronic
987586391 5:19862512-19862534 GTAATGTTACATTTTACTGAAGG + Intronic
987978340 5:25045055-25045077 ATTTGGTAGCATTTTACTGTTGG - Intergenic
988620356 5:32816516-32816538 CTTTGGTAACAGTTTAGTGAGGG + Intergenic
989212279 5:38867752-38867774 CCTAGGTTAAATTTTAATGAGGG + Intronic
989795400 5:45465138-45465160 ATTTAGTAACAATTTACTGAGGG - Intronic
990075737 5:51843854-51843876 CTTAGGCAAAAGTTTACTGCAGG - Intergenic
990160568 5:52935833-52935855 CCTTGGTAACATTTTAGTGTAGG - Intronic
990222345 5:53606305-53606327 CTTAGGGGACCTTTTACTCATGG + Intronic
992900187 5:81287055-81287077 CTTTGGTTTCATTTTACAGATGG - Intergenic
993025565 5:82641720-82641742 CTTATTTAACTTTGTACTGAGGG + Intergenic
993415355 5:87622325-87622347 CTTAGCTAATATCTAACTGAGGG + Intergenic
994400520 5:99274207-99274229 CTCAGGGAAGATTTTACTCATGG - Intergenic
996589488 5:125129978-125130000 CTTAAGTAATTTGTTACTGAAGG + Intergenic
1000379439 5:160615549-160615571 CTTAGCAAACATTTGAATGAAGG + Intronic
1000619588 5:163468640-163468662 GTTAGCTATCATTTTACTGAGGG + Intronic
1000715547 5:164639475-164639497 CTTTAGTAACATTTTAATGTGGG + Intergenic
1000750284 5:165086931-165086953 CTTTGGTAACACTTTTGTGAAGG + Intergenic
1001871412 5:175159432-175159454 CTTAGGAAAAATTCAACTGAAGG - Intergenic
1003262836 6:4537387-4537409 TCTATGCAACATTTTACTGAAGG + Intergenic
1005277194 6:24231610-24231632 CTTAGGAAACCTTTATCTGAAGG + Intronic
1008266522 6:49434466-49434488 ACAAGGTCACATTTTACTGATGG + Intronic
1008974893 6:57413705-57413727 ATTAGTTAAAATTTTACTGGAGG + Intronic
1010367549 6:75069238-75069260 TTTATTTAACATTATACTGAAGG - Intergenic
1010487081 6:76427624-76427646 ATAATGTAACATTTTACTAATGG - Intergenic
1011920009 6:92562296-92562318 CGAAGCTAACATTTTACTGAAGG - Intergenic
1012873802 6:104701768-104701790 CTTAGTTACCTTATTACTGAGGG - Intergenic
1012915689 6:105168102-105168124 TTTGGGTAACATCTGACTGATGG - Intronic
1014367047 6:120556724-120556746 CTAAGGTATAAGTTTACTGAGGG - Intergenic
1014860764 6:126464979-126465001 TTTAGGTAATATTGTACTGGAGG + Intergenic
1016893541 6:149031334-149031356 TTTAGTGAACATTTTTCTGAGGG + Intronic
1017194689 6:151686776-151686798 CTTAGGTTACACTATTCTGATGG + Intronic
1018441561 6:163818548-163818570 CCTATGTAAGATTTTACAGAGGG - Intergenic
1018882325 6:167896915-167896937 CTTCAGTAACACTTAACTGAAGG - Exonic
1020285139 7:6672921-6672943 CATAGGGAACAGTTAACTGAGGG - Intergenic
1020806208 7:12793339-12793361 TATAGGTACCATTTTATTGATGG + Intergenic
1021046625 7:15930748-15930770 GTTAGGAAACATTTCACTTAAGG - Intergenic
1021107630 7:16656697-16656719 ATTAGTTGACATTCTACTGAAGG + Intronic
1028219981 7:88185786-88185808 CTTAGTTAGCATTTCCCTGATGG - Intronic
1036175701 8:6536349-6536371 TTGAGCTAACATTTTGCTGAGGG - Intronic
1036782199 8:11657494-11657516 CTTAGCTACTATTATACTGATGG - Intergenic
1039380876 8:37083831-37083853 CTTTGGAGACATTTTAGTGACGG - Intergenic
1043239112 8:77909111-77909133 CATAGGTAACATTTTATGGATGG + Intergenic
1043721928 8:83555560-83555582 CTTAATTTGCATTTTACTGATGG + Intergenic
1043733308 8:83712839-83712861 CTTAGTCAAAATTTTACTTATGG + Intergenic
1044017648 8:87064118-87064140 CAAGAGTAACATTTTACTGAAGG - Intronic
1047018166 8:120745602-120745624 TGTCAGTAACATTTTACTGAAGG + Intronic
1047347635 8:124043404-124043426 CTTAGCTAACATTTTGATGATGG - Intronic
1049854931 8:144855548-144855570 GTTAGGTAGCATCTTTCTGAGGG - Intergenic
1050573422 9:6966484-6966506 TTTATGTAACATTTTACTGAAGG + Intronic
1051622622 9:19067284-19067306 CCTATGTTACATATTACTGATGG + Intronic
1052196423 9:25721018-25721040 CTTAAGTTACATTTCACTGAAGG - Intergenic
1058332900 9:103786157-103786179 CATCGGTAATATTTAACTGAAGG - Intergenic
1059165710 9:112074558-112074580 CTTACGTTAAATCTTACTGATGG - Intronic
1059516559 9:114901177-114901199 CATAGATATCATTTTACTCATGG + Intronic
1186974358 X:14884786-14884808 TTTAGGTAAAATGTTACTTAGGG + Intronic
1188930765 X:36108373-36108395 CTTATGGGACATTTTAATGAAGG - Intronic
1188983291 X:36747802-36747824 CATAGTCAACATTATACTGAAGG - Intergenic
1189142628 X:38622695-38622717 CTTACTTTACATTCTACTGAAGG - Intronic
1193258222 X:79375516-79375538 CTTAGTTAATATTTTACTTAGGG - Intergenic
1194017184 X:88637525-88637547 GTAAGGGAACATCTTACTGACGG + Intergenic
1194141000 X:90209448-90209470 ATGTGGTAACATATTACTGAAGG - Intergenic
1196402882 X:115334311-115334333 CTGAGGAAAAATTTTACAGAGGG - Intergenic
1197286560 X:124601923-124601945 CTTCTCTAACCTTTTACTGATGG + Intronic
1197722946 X:129757231-129757253 CTTAGAAAACATTTTACTTGAGG - Intronic
1198952934 X:142093601-142093623 TTTAGGTGAAATTCTACTGAGGG - Intergenic