ID: 1172941398

View in Genome Browser
Species Human (GRCh38)
Location 20:38656984-38657006
Sequence CCAAGGTAGTAGTGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172941388_1172941398 25 Left 1172941388 20:38656936-38656958 CCAATTGGCACATGTGGACCACA No data
Right 1172941398 20:38656984-38657006 CCAAGGTAGTAGTGGAGCCCAGG No data
1172941392_1172941398 7 Left 1172941392 20:38656954-38656976 CCACACAGAGGGGTGCTCTGCCT No data
Right 1172941398 20:38656984-38657006 CCAAGGTAGTAGTGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172941398 Original CRISPR CCAAGGTAGTAGTGGAGCCC AGG Intergenic
No off target data available for this crispr