ID: 1172941680

View in Genome Browser
Species Human (GRCh38)
Location 20:38658684-38658706
Sequence GGCAGGGGGCAGAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172941666_1172941680 30 Left 1172941666 20:38658631-38658653 CCTGAGATGGACTCTGCATAGCT No data
Right 1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172941680 Original CRISPR GGCAGGGGGCAGAGTGGGCA GGG Intergenic
No off target data available for this crispr