ID: 1172948076

View in Genome Browser
Species Human (GRCh38)
Location 20:38703782-38703804
Sequence GCAGGGACTCCTGTCCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172948076_1172948090 19 Left 1172948076 20:38703782-38703804 CCCTTATGGACAGGAGTCCCTGC No data
Right 1172948090 20:38703824-38703846 CAGGCTCCAGCCACATCAAAAGG No data
1172948076_1172948081 0 Left 1172948076 20:38703782-38703804 CCCTTATGGACAGGAGTCCCTGC No data
Right 1172948081 20:38703805-38703827 TCCCCTCTCCGGCCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172948076 Original CRISPR GCAGGGACTCCTGTCCATAA GGG (reversed) Intergenic