ID: 1172950623

View in Genome Browser
Species Human (GRCh38)
Location 20:38721247-38721269
Sequence CACAAGAAAAAGCCTGCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172950623_1172950630 16 Left 1172950623 20:38721247-38721269 CCAATCGCAGGCTTTTTCTTGTG No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172950623 Original CRISPR CACAAGAAAAAGCCTGCGAT TGG (reversed) Intergenic
No off target data available for this crispr