ID: 1172950630

View in Genome Browser
Species Human (GRCh38)
Location 20:38721286-38721308
Sequence CCCAGCCCCACAACGAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172950619_1172950630 25 Left 1172950619 20:38721238-38721260 CCCCCAGATCCAATCGCAGGCTT No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data
1172950621_1172950630 23 Left 1172950621 20:38721240-38721262 CCCAGATCCAATCGCAGGCTTTT No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data
1172950620_1172950630 24 Left 1172950620 20:38721239-38721261 CCCCAGATCCAATCGCAGGCTTT No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data
1172950622_1172950630 22 Left 1172950622 20:38721241-38721263 CCAGATCCAATCGCAGGCTTTTT No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data
1172950623_1172950630 16 Left 1172950623 20:38721247-38721269 CCAATCGCAGGCTTTTTCTTGTG No data
Right 1172950630 20:38721286-38721308 CCCAGCCCCACAACGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172950630 Original CRISPR CCCAGCCCCACAACGAGAAC TGG Intergenic
No off target data available for this crispr