ID: 1172951284

View in Genome Browser
Species Human (GRCh38)
Location 20:38724796-38724818
Sequence GAGCGGCATGTTCGCCAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172951275_1172951284 11 Left 1172951275 20:38724762-38724784 CCACGTCCGTGTCCAACAAGTCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 110
1172951277_1172951284 5 Left 1172951277 20:38724768-38724790 CCGTGTCCAACAAGTCCCAGGCC 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 110
1172951280_1172951284 -10 Left 1172951280 20:38724783-38724805 CCCAGGCCAAGATGAGCGGCATG 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 110
1172951274_1172951284 20 Left 1172951274 20:38724753-38724775 CCAACGTGGCCACGTCCGTGTCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 110
1172951278_1172951284 -1 Left 1172951278 20:38724774-38724796 CCAACAAGTCCCAGGCCAAGATG 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172951284 Original CRISPR GAGCGGCATGTTCGCCAGGA TGG Exonic
900611504 1:3546490-3546512 GAGCAGCCTGTGGGCCAGGAAGG + Intronic
903079859 1:20801314-20801336 TTTCGGCATGTTGGCCAGGATGG + Intergenic
907152035 1:52297907-52297929 GAGGCGCATGTTGGCCAGGCTGG + Intronic
909698566 1:78494090-78494112 GAGAGGTATGTTTGGCAGGAAGG + Intronic
910717085 1:90244033-90244055 GTTCGCCATGTTGGCCAGGATGG + Intergenic
915173288 1:153993715-153993737 TAGTGGCATGTTGGCCAGGCTGG - Intronic
915208977 1:154292548-154292570 TATCGCCATGTTTGCCAGGATGG + Intergenic
921735194 1:218619616-218619638 GAGAGGCATGTGAGCCAGGTGGG + Intergenic
922754287 1:228086316-228086338 TATCACCATGTTCGCCAGGATGG - Intronic
1065796415 10:29312303-29312325 GAGCTGCATGTGGCCCAGGATGG + Intronic
1066538512 10:36418286-36418308 GAGATGGATGTTAGCCAGGATGG + Intergenic
1067895214 10:50171739-50171761 GCGTGTCATGTTGGCCAGGATGG + Intergenic
1067953769 10:50770239-50770261 GCGTGTCATGTTGGCCAGGATGG - Intronic
1069497137 10:68915518-68915540 TATCGCCATGTTGGCCAGGATGG - Intronic
1069923032 10:71828922-71828944 GAGAGGGATGTTGGCCATGAAGG + Exonic
1070513054 10:77178509-77178531 GATCGCCATGTTGGCCAGGCTGG - Intronic
1075832388 10:125422423-125422445 AAGAGCCATGTTAGCCAGGATGG + Intergenic
1078841371 11:15078343-15078365 GAGCTGCATGATCAACAGGATGG - Intronic
1080650652 11:34220281-34220303 GAACGGCATGTCAGCCAAGAAGG - Intronic
1081598262 11:44474101-44474123 AAGTGGCATGTTCTTCAGGAAGG + Intergenic
1084034678 11:66501998-66502020 GGCCGCCATGTTGGCCAGGATGG - Intronic
1084727726 11:70952932-70952954 CAGGGCCATGTTCCCCAGGAAGG + Intronic
1090398544 11:126434466-126434488 TAGGGGCATGTCTGCCAGGAGGG + Intronic
1099424170 12:82502280-82502302 TAGCTCCATGTTTGCCAGGATGG + Intergenic
1099874873 12:88392257-88392279 TAGAGACATGTTAGCCAGGATGG + Intergenic
1101631250 12:106497035-106497057 GGGCGGCATGTGGCCCAGGACGG + Intronic
1102284533 12:111644950-111644972 GTTCGGCATGTTGGCCAGGCTGG + Intronic
1102463038 12:113112072-113112094 GAGCACCAGGTGCGCCAGGATGG - Exonic
1102849769 12:116230206-116230228 GGGCTGCATGTTGGCCAGGCTGG - Intronic
1106922802 13:34581892-34581914 CAGCAGCCTGTTTGCCAGGAAGG - Intergenic
1109187002 13:59281755-59281777 CATCGCCATGTTCGCCAGGCTGG - Intergenic
1109938457 13:69326752-69326774 GAGACGGATGTTAGCCAGGATGG - Intergenic
1112084079 13:96009610-96009632 TATCAGCATGTTGGCCAGGATGG - Intronic
1114481277 14:23036470-23036492 GATCCGCTTGTTAGCCAGGATGG + Intergenic
1116406470 14:44572795-44572817 GAGGGGGGTGTTAGCCAGGATGG - Intergenic
1118264055 14:64277426-64277448 TTTCGGCATGTTAGCCAGGATGG - Intronic
1122715496 14:103694433-103694455 AAACGCCATGTTAGCCAGGATGG - Intergenic
1123814151 15:23959758-23959780 TATCAGCATGTTAGCCAGGATGG - Intergenic
1132924385 16:2420937-2420959 GTGTGCCATGTTCGCCAGGCTGG + Intergenic
1133252476 16:4492520-4492542 TTTCAGCATGTTCGCCAGGATGG - Intronic
1133383379 16:5349476-5349498 GATCGCCATGTTGGCCAGGCTGG - Intergenic
1136652692 16:31686439-31686461 GACGGGCATGTTGGCCAGGCTGG - Intergenic
1139729231 16:68928495-68928517 GGGCACCATGTTAGCCAGGATGG + Intronic
1143021936 17:3921441-3921463 GAGGGGCAGGGTCCCCAGGAGGG + Intergenic
1143024911 17:3935820-3935842 GAGCCACATGTTGGCCAGGCTGG + Intronic
1143731965 17:8886531-8886553 GAGTAGCATGTCAGCCAGGATGG + Exonic
1144314687 17:14048659-14048681 TAGAGACATGTTGGCCAGGATGG + Intergenic
1148042356 17:44718232-44718254 GACAGCCATGTTGGCCAGGATGG - Intronic
1149245421 17:54700025-54700047 TATCACCATGTTCGCCAGGATGG + Intergenic
1152422887 17:80203643-80203665 GACTGGCATGGCCGCCAGGATGG + Intronic
1153885084 18:9457373-9457395 GAGGGCCATGTTCCCCAGGAGGG - Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1157017477 18:43734591-43734613 ATGAGGCATGTTCGCCAGGCTGG - Intergenic
1159298057 18:66522443-66522465 GTGCGCCATGTTGGCCAGGCTGG + Intronic
1159456965 18:68670932-68670954 GACCACCATGTTAGCCAGGATGG - Intergenic
1161709656 19:5840965-5840987 TAGAGACATGTTAGCCAGGATGG + Intergenic
1162158982 19:8697991-8698013 GAGCAGCATCTCCGCCAGGAAGG + Exonic
1162367774 19:10259677-10259699 GAGCAGCTTGTCCTCCAGGAAGG - Exonic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1163654005 19:18535113-18535135 CAGGGCCATGTTCCCCAGGATGG + Intronic
1164592799 19:29515429-29515451 GAGCGGCAAGTGCACCTGGAGGG - Intergenic
1166212036 19:41312965-41312987 GAGCGCCATGTTGGCCAAGCTGG + Intronic
1166406698 19:42526744-42526766 TAGGGACATGTTCACCAGGAGGG + Intronic
1167043772 19:47038319-47038341 TATCGCCATGTTGGCCAGGATGG - Intronic
1167196168 19:48030374-48030396 GAGCGGTATCTTTGCCAGGATGG - Exonic
1167714641 19:51134352-51134374 GACCACCATGTTGGCCAGGATGG + Intronic
927454066 2:23234114-23234136 TAGCGCCATGTTGGCCAGGCTGG + Intergenic
931453270 2:62386404-62386426 TAGAGACATGTTGGCCAGGATGG + Intergenic
932205834 2:69881885-69881907 GACCACCATGTTGGCCAGGAAGG + Intergenic
936043461 2:109167766-109167788 TTGCGCCATGTTAGCCAGGATGG + Intronic
936907554 2:117554702-117554724 GTGCACCATGTTAGCCAGGATGG + Intergenic
939328111 2:140721752-140721774 TAGCACCATGTTAGCCAGGATGG + Intronic
939427522 2:142058469-142058491 GGGCTGCATGTGGGCCAGGATGG + Intronic
1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG + Exonic
1174858270 20:54067177-54067199 TTGCGCCATGTTGGCCAGGATGG - Intronic
1177457234 21:21355802-21355824 GACCAGCATGTTGGCCAGGCTGG + Intronic
1177793292 21:25743853-25743875 GACTGGCATGTTGGCCAGGATGG - Intronic
1178735096 21:35141910-35141932 GAACAGCATGTTCGCCTGGTTGG - Intronic
1182802119 22:33040191-33040213 GAGATCCATGTTAGCCAGGATGG + Intronic
1183999033 22:41658716-41658738 TAGAGACATGTTGGCCAGGATGG - Intronic
950557005 3:13702128-13702150 GAGAGGCATGGTGGCCAGGAAGG - Intergenic
955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG + Intronic
957268345 3:77996869-77996891 CAGCAGCATATTCGCCAGAATGG + Intergenic
968666317 4:1824125-1824147 GATCGCCATGTTGGCCAGGCTGG - Intronic
968844344 4:3031611-3031633 GAACGGCAGGTTCAACAGGATGG + Intronic
971731427 4:30387088-30387110 TATCAGCATGTTGGCCAGGATGG + Intergenic
972785956 4:42327024-42327046 GAGCACCATGTTGGCCAGGCTGG - Intergenic
983906387 4:173186951-173186973 GAGACGGATGTTGGCCAGGATGG + Intronic
988729293 5:33954382-33954404 GAACAGCATGTTGGACAGGAAGG + Exonic
992357549 5:76001401-76001423 GACCAGCGTGTTAGCCAGGATGG - Intergenic
996194422 5:120585976-120585998 GATCACCATGTTGGCCAGGATGG - Intronic
1002046901 5:176546723-176546745 GAGCACCATGTTGGCCAGGCTGG - Intronic
1003211949 6:4076681-4076703 TAGCGACATGTTGGCCAGGCTGG - Intronic
1004047267 6:12038474-12038496 TTTCGGCATGTTGGCCAGGATGG - Intronic
1004124317 6:12857412-12857434 GACAGCCATGTTGGCCAGGATGG - Intronic
1005647166 6:27851624-27851646 GAGCATCATGCTCTCCAGGAGGG + Intronic
1006674028 6:35749271-35749293 GTTCGGCATGTTGGCCAGGCTGG + Intergenic
1009589575 6:65648947-65648969 TATCAGCATGTTAGCCAGGATGG - Intronic
1011818877 6:91227013-91227035 TAGTAGCATGTTGGCCAGGATGG - Intergenic
1012278663 6:97302958-97302980 TTTCGGCATGTTGGCCAGGATGG + Intergenic
1018925750 6:168205854-168205876 GACGGGGATGTTAGCCAGGATGG + Intergenic
1021632312 7:22659348-22659370 GAGGGGCAAGTTCTCTAGGAGGG + Intergenic
1036432270 8:8702165-8702187 GAGCGGCCGGGACGCCAGGAGGG + Exonic
1037855403 8:22367607-22367629 GCGCGGCCTGTCCGCCTGGAGGG + Intronic
1037995627 8:23350381-23350403 GAGCCCCATGTTGGCCAGGCTGG - Intronic
1039024409 8:33242136-33242158 TTTCGGCATGTTGGCCAGGATGG - Intergenic
1041259966 8:56012894-56012916 GAGCTTCATGTTCACCAGGAAGG - Intergenic
1048489394 8:134878526-134878548 GAGAGGCATGTCAGCAAGGAGGG - Intergenic
1049232317 8:141490770-141490792 GAGGGGCATCTTCAGCAGGAAGG + Intergenic
1054843292 9:69765680-69765702 TAGCAGAATGTTGGCCAGGATGG - Intergenic
1055579083 9:77689163-77689185 TTTCGGCATGTTGGCCAGGATGG + Intergenic
1056270051 9:84938605-84938627 GAGTGGCATATTCCCCAGGATGG + Intronic
1057384839 9:94598070-94598092 GAGATGCGTGTTAGCCAGGATGG - Intergenic
1188481985 X:30645623-30645645 TAGAGACATGTTAGCCAGGATGG - Intergenic
1188967189 X:36568839-36568861 GAGAGGCCTGGTCGCCAAGAAGG - Intergenic
1189811889 X:44788608-44788630 TTGCGCCATGTTGGCCAGGATGG - Intergenic
1195363435 X:104106464-104106486 GAGGGGCATGATGGCCAGGACGG + Intronic
1196719938 X:118844224-118844246 GATCACCATGTTGGCCAGGATGG - Intergenic
1200884984 Y:8258768-8258790 GACTGGCATGTTCCCCAGCAGGG + Intergenic