ID: 1172951779

View in Genome Browser
Species Human (GRCh38)
Location 20:38727076-38727098
Sequence CAGGAACAGAATGAGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 3, 3: 86, 4: 485}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172951779_1172951789 19 Left 1172951779 20:38727076-38727098 CCCAACTCCTCATTCTGTTCCTG 0: 1
1: 0
2: 3
3: 86
4: 485
Right 1172951789 20:38727118-38727140 AGTATCTCCCTTCCCTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172951779 Original CRISPR CAGGAACAGAATGAGGAGTT GGG (reversed) Intronic
900722326 1:4185302-4185324 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
901077412 1:6563988-6564010 CAGGAGGAGAAGGAGGAGTCTGG + Intronic
901743827 1:11359577-11359599 CAGGAACTGAGTGGGGAGTGGGG - Intergenic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902455117 1:16527865-16527887 AAGGAACAGGATGTGGACTTAGG + Intergenic
903103873 1:21057037-21057059 CAGCAAGAGAATGAGAATTTTGG - Intronic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904004350 1:27356039-27356061 CAGGAACTGAATGTGGATTCAGG - Exonic
904281563 1:29424094-29424116 CAGGAAGGGAATGAAGAGTTGGG + Intergenic
904439838 1:30523064-30523086 CAGGAACAGCAGGAGAATTTGGG - Intergenic
905300767 1:36985022-36985044 CAGGAACAGAAAGATGATTCTGG + Intronic
905375533 1:37517986-37518008 CAGGAACACAAAGAAAAGTTGGG - Intergenic
906354407 1:45091789-45091811 CAGGAAGGGAAGGAGAAGTTGGG - Intronic
906548228 1:46637932-46637954 CAGAAACAGAAGGATGAATTGGG - Intronic
907662900 1:56409522-56409544 GAGGAAATGAATGAGTAGTTGGG - Intergenic
908413152 1:63886574-63886596 CAGGAACTGAGTGTGGAGATTGG - Intronic
908629736 1:66089558-66089580 CAGAAACAAGATGGGGAGTTTGG - Intronic
908752672 1:67439597-67439619 TAGGAAGAGAATGAGGAGGCTGG - Intergenic
909482873 1:76144175-76144197 CTGGCACAGAATGAGAAGATGGG + Intronic
910097678 1:83542249-83542271 CAGGAACAAAAGGAAGAGGTTGG + Intergenic
910653245 1:89592575-89592597 CAGGAGTACAATGAGGAGTGAGG - Intronic
911510410 1:98803317-98803339 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
911603262 1:99869989-99870011 CAGAATCAGAATCAGGAGTTTGG - Intronic
911832774 1:102575714-102575736 CAGGAACAAAATGATGATGTCGG - Intergenic
912044478 1:105437241-105437263 CAGGAACAGCCTGAGGCCTTGGG + Intergenic
913563464 1:120046941-120046963 CAGGAACAAAATGAGGAACCGGG + Intronic
913634659 1:120746636-120746658 CAGGAACAAAATGAGGAACCGGG - Intergenic
914003112 1:143709266-143709288 CAGGAGAAGAAGGAGCAGTTGGG + Intergenic
914284058 1:146206305-146206327 CAGGAACAAAATGAGGAACCGGG + Intronic
914545089 1:148657044-148657066 CAGGAACAAAATGAGGAACCGGG + Intronic
914621478 1:149413644-149413666 CAGGAACAAAATGAGGAACCGGG - Intergenic
915252153 1:154598214-154598236 CAGGAGCAGACAGAGGAGCTGGG + Intronic
915360414 1:155283022-155283044 CAGGAACAGAATGAGGGTTCGGG + Intronic
915708653 1:157871957-157871979 AAGGAACAGATTCAGGACTTAGG - Intronic
916329037 1:163594295-163594317 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916871469 1:168919062-168919084 CAAGGGCAGAAGGAGGAGTTTGG - Intergenic
917152005 1:171956084-171956106 CAGGAGCAGAATGATATGTTTGG - Intronic
917243719 1:172977013-172977035 CAAGAACAGAATGAAGTGATGGG + Intergenic
918346509 1:183611900-183611922 AGTGAACTGAATGAGGAGTTTGG + Intergenic
918410803 1:184256172-184256194 CAGGGAGAGAATAAAGAGTTGGG - Intergenic
919752830 1:201048823-201048845 AGGGGACAGAATGATGAGTTGGG + Intronic
919932233 1:202228848-202228870 GAGCAACAGAATGAGCATTTGGG + Intronic
921417642 1:214909132-214909154 CAGGAAGAAACTGAGAAGTTGGG + Intergenic
921453216 1:215334869-215334891 CAGGAACAGAATGAAATATTGGG - Intergenic
921796109 1:219346574-219346596 CAGGAAAAGAATGAAAAGATAGG + Intergenic
922230617 1:223682438-223682460 CAGGATCAGACTGTGGAGATTGG - Intergenic
922894579 1:229090174-229090196 CAGGAACAGAATGATGCCTCTGG - Intergenic
923612893 1:235511085-235511107 CAGGAACAGAGTGAGTGGTGAGG + Intergenic
924098109 1:240575167-240575189 AAGGAACAGATTGTGGAGCTGGG - Intronic
924180881 1:241437617-241437639 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1063079383 10:2751078-2751100 CAGGAGTGGACTGAGGAGTTAGG + Intergenic
1063100741 10:2947599-2947621 CAGGAACAGAAAGACAAATTTGG - Intergenic
1063363378 10:5474757-5474779 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1063433544 10:6012146-6012168 CAGGAACAGAAGGATGAATGAGG - Exonic
1063438633 10:6054297-6054319 CAGGAAAAAAATGTGGAGGTAGG + Intronic
1066268706 10:33800970-33800992 CAGCAAGAGAAAGTGGAGTTCGG - Intergenic
1066363131 10:34750571-34750593 CAGGAGAGGAGTGAGGAGTTAGG + Intronic
1067217166 10:44312768-44312790 CAGGCACAGCCTGAGGAGGTGGG - Intergenic
1067281090 10:44873669-44873691 CACTCACAGAATTAGGAGTTGGG + Intergenic
1067844347 10:49708034-49708056 CATGAACAGAACCAGGAGATGGG - Intronic
1068330992 10:55568596-55568618 AAAGAACAGAATTATGAGTTTGG + Intronic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1068763146 10:60734024-60734046 CAGCAACAGAATGGGGAGCAGGG + Intergenic
1068894899 10:62188559-62188581 CAGGAACAGAATGAGCAAAGGGG - Intronic
1069091342 10:64202993-64203015 CAGGGGCAAAATGAGGGGTTTGG - Intergenic
1069940382 10:71951449-71951471 CAGGAAGGGAAGGAGGAGTCTGG + Intergenic
1071473144 10:86001465-86001487 CAGGCTCAGAAGGAGGAATTTGG - Intronic
1071483995 10:86085806-86085828 CAGGAACAGGCTGGGGAATTAGG + Intronic
1072111357 10:92323200-92323222 CAGAAACAGAAAGAGGGGCTGGG - Intronic
1074019249 10:109566006-109566028 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1074936920 10:118190861-118190883 CAGGAACAGAAAGAGGAGCCGGG + Intergenic
1075014135 10:118897720-118897742 TTGGAACAGAAAGAGGAGTGGGG - Intergenic
1076342758 10:129760815-129760837 CAGGAAGAGATGGAGGAGGTGGG - Intronic
1076427031 10:130374150-130374172 CAGGAACAGAATGATGAACAAGG + Intergenic
1077589677 11:3481744-3481766 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1077883575 11:6369452-6369474 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1078135153 11:8645705-8645727 CAAGGACAGGCTGAGGAGTTGGG + Intronic
1078598247 11:12708077-12708099 CAGGACAAGAATGATGAGTGGGG + Intronic
1078789240 11:14526268-14526290 GAGGAACAGAAAGAGGACTGGGG - Intronic
1078795118 11:14584634-14584656 CAGGAATAGAATCAGGGCTTTGG - Intronic
1078844836 11:15111473-15111495 CAGGAGAAGAATGTGGAGTCAGG + Intergenic
1078882320 11:15464333-15464355 CAGGTACAGAAAGAGGAGCTAGG + Intergenic
1079317536 11:19421915-19421937 CAGCAAGAAAATGAGGAGTCAGG - Intronic
1079632558 11:22695506-22695528 CATGAAAAGAATGAGCAGGTTGG - Intronic
1079847466 11:25489288-25489310 AAGGAACAGAAAGAGGAATGGGG + Intergenic
1080655648 11:34256071-34256093 CAGGAACAGAAATAGGTGTTGGG - Intronic
1080934744 11:36850979-36851001 CAGGAGGAGACTGAGGAGTAAGG - Intergenic
1081159948 11:39738211-39738233 AAGGAACGGAAAGAGGAGTGAGG - Intergenic
1081551020 11:44112751-44112773 CTGGAACAGAATAACAAGTTTGG + Intronic
1082200737 11:49363614-49363636 CAGAAAAATAATGAGGAGTAAGG - Intergenic
1083166884 11:60894607-60894629 TATGAACATAAAGAGGAGTTTGG - Intronic
1083224001 11:61273330-61273352 CAGGCACAGAATGATGAGGGCGG + Intronic
1083644438 11:64164511-64164533 CCAGAACAGCAGGAGGAGTTTGG - Intronic
1084245394 11:67853518-67853540 AAGGAACAGAAAGAGGAGTGAGG + Intergenic
1084354446 11:68627953-68627975 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1084613066 11:70216398-70216420 AAGGAACAGAAAAAGGAGTGGGG + Intergenic
1084827290 11:71741060-71741082 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1085988227 11:81809852-81809874 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1086134616 11:83433673-83433695 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1086215697 11:84377994-84378016 CAGTGATAGAATGAGGATTTGGG - Intronic
1086550430 11:88046831-88046853 AAGCAACAGAAAGAGGAGTGGGG - Intergenic
1087597069 11:100267659-100267681 CAGGAGCAGAATGAGGTTTAGGG + Intronic
1088049652 11:105496816-105496838 CTGGAACAGAAAAAGGATTTAGG - Intergenic
1088072315 11:105803984-105804006 GAGGAGAAGAATGAGGAATTTGG + Intronic
1088426085 11:109704987-109705009 CAGCAACAGAATGAGCTGATAGG + Intergenic
1088555174 11:111053835-111053857 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1089118583 11:116115429-116115451 CAGAAACAGACTGAGGAACTTGG + Intergenic
1089221241 11:116873641-116873663 CAGGAACAGAGTGGGGAGGACGG + Intronic
1089666137 11:120021203-120021225 CAGGAGCAGGAGGAGGGGTTGGG - Intergenic
1089809171 11:121117568-121117590 CAGGAAGAGAATGAGGAAAGGGG - Intronic
1090464517 11:126922455-126922477 CAGGCACACGATGATGAGTTTGG - Intronic
1090604507 11:128407395-128407417 AAAGAAAAGAATGAGCAGTTGGG + Intergenic
1091055354 11:132413109-132413131 TAGGAAAAGCATGCGGAGTTGGG - Intergenic
1091316364 11:134616711-134616733 CAGGAAGATAAGGAGAAGTTTGG + Intergenic
1091562400 12:1625048-1625070 GAGGATCAGAATGAGGTCTTGGG + Intronic
1091694966 12:2622288-2622310 CAGGACCACAGTGAGGAGTGTGG + Intronic
1092415967 12:8290650-8290672 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1092571378 12:9726457-9726479 CAGGGACAAAATGTGAAGTTAGG + Intronic
1092914002 12:13173130-13173152 CAGAAACAGAATGTTGGGTTTGG + Intergenic
1092924599 12:13261864-13261886 AAGGAACGGAAAGAGGAGTGAGG + Intergenic
1093812614 12:23508094-23508116 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1095571734 12:43690768-43690790 CAGGGACAGAATTAAGAATTTGG + Intergenic
1097541973 12:60954050-60954072 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1097592551 12:61590298-61590320 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1098146620 12:67504087-67504109 AAGGAACAGAATGGGGAGCCTGG + Intergenic
1098282959 12:68879975-68879997 CAGGAGCAGAATGAGGTGATGGG + Intronic
1098629810 12:72710960-72710982 AAGGAACAGATAGAGGAGTGGGG + Intergenic
1099540812 12:83905024-83905046 CAGGCACAGAATGTGGGGTGGGG + Intergenic
1099645115 12:85343110-85343132 CAGGAACACAATGCCAAGTTTGG - Intergenic
1099762811 12:86942449-86942471 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1100352639 12:93798994-93799016 CAGGAACATAATTAGGAGTGGGG + Intronic
1101075593 12:101126673-101126695 AAGGAATAGAAAGAGGAGTCTGG - Intronic
1101563303 12:105880900-105880922 CAGAAACAGGGTGAGGACTTGGG + Intergenic
1101830617 12:108253668-108253690 CAGGAAGAGGATGAGGAGATGGG - Intergenic
1102141931 12:110622369-110622391 CAGGGACATAAAGATGAGTTAGG + Intronic
1102621782 12:114201901-114201923 TAGGAGCAGGATCAGGAGTTAGG + Intergenic
1103088529 12:118080830-118080852 CAGGGACAGAATGCGGATTGGGG + Intronic
1103590365 12:121987857-121987879 TAGGAACAGAACCTGGAGTTGGG - Intronic
1104368153 12:128196402-128196424 CAGGAAAAGAAAGAGAAGATGGG + Intergenic
1104491902 12:129201475-129201497 CATGAACTCAATGAGGAGTTTGG - Intronic
1104494341 12:129222738-129222760 CAGGAACTGGGTGAGGTGTTGGG + Intronic
1104540088 12:129655943-129655965 GAGGAACCGAAAGAGAAGTTTGG - Intronic
1105647195 13:22333666-22333688 AGGAGACAGAATGAGGAGTTGGG + Intergenic
1105909623 13:24850870-24850892 CAGTCACAGAATGGGGAGTTGGG - Intronic
1105965199 13:25377431-25377453 CAGGAATAGAGTAAGGAGTGGGG + Intronic
1106776997 13:33017595-33017617 CAGGAAGAGAATGAGCAGGGTGG + Intronic
1106796799 13:33215100-33215122 CAGGAATAGAATGAGTACTTGGG + Intronic
1107220077 13:37971238-37971260 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1107313258 13:39103374-39103396 CTGGTTCAGAATCAGGAGTTTGG - Intergenic
1108090899 13:46848918-46848940 CAGGAATAGAAACAGGAGATAGG + Intronic
1108202913 13:48060023-48060045 AAGGAACAGAAAAAGGAGTGGGG - Intronic
1108947659 13:56043954-56043976 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1109343818 13:61092172-61092194 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1109353135 13:61208447-61208469 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1109437973 13:62331421-62331443 CAAGAACAGAATGAAGAGAATGG - Intergenic
1109528510 13:63607265-63607287 CATGAACAAAAAGAGAAGTTTGG + Intergenic
1111811566 13:93098225-93098247 GTGGAACACACTGAGGAGTTTGG + Intergenic
1111816828 13:93164236-93164258 CAGGAACAAAGTCAGTAGTTTGG + Intergenic
1112214607 13:97417336-97417358 AAGGAACAGAAACAAGAGTTTGG + Intergenic
1112686909 13:101839688-101839710 CAGCAACAAAAAGAGCAGTTGGG - Intronic
1113584140 13:111451577-111451599 GAGCAACAGAATGAGGTGATAGG + Intergenic
1114245209 14:20906395-20906417 CAGAAACAGAATGAAAAGTCTGG - Intergenic
1114263616 14:21057853-21057875 GTGGAACAGAGTGAGGAGGTAGG - Exonic
1114512507 14:23274551-23274573 AATGAACAGAGTGAGGATTTTGG + Exonic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1115886395 14:37976427-37976449 CATGACCAGAATGAGAAGTGAGG + Intronic
1117355355 14:54918828-54918850 CAACACCAGAATGAGGAGTTGGG - Intergenic
1117957692 14:61135485-61135507 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1118492513 14:66274915-66274937 CAAGGAAAGAAGGAGGAGTTAGG + Intergenic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119796711 14:77404722-77404744 CAGGAAGAAAATGAGGAGAACGG + Intronic
1119938046 14:78611065-78611087 CAGGAAAGCAAGGAGGAGTTGGG - Intronic
1120153399 14:81063825-81063847 CAGGAGCAGGGAGAGGAGTTGGG + Intronic
1120452528 14:84686800-84686822 CAGCAACAGAATGAAGAGGTAGG + Intergenic
1120618461 14:86734967-86734989 AAGGAACGGAAAGAGGAGTGAGG - Intergenic
1121888620 14:97568035-97568057 CAGGAACAGGACAAGGAGTAAGG - Intergenic
1123468706 15:20534563-20534585 CAGGAACAGGAAGAGAAGATGGG - Exonic
1123649357 15:22466166-22466188 CAGGAACAGGAAGAGAAGATGGG + Exonic
1123649384 15:22466352-22466374 CAGGAACAGGAAGAGAAGATGGG + Exonic
1123649410 15:22466520-22466542 CAGGAACAGGAAGAGAAGATGGG + Exonic
1123729028 15:23129792-23129814 CAGGAACAGGAAGAGAAGATGGG - Exonic
1123747192 15:23327257-23327279 CAGGAACAGGAAGAGAAGATGGG - Intergenic
1124017141 15:25886939-25886961 CTGGCACAGAATGGGGAGGTTGG - Intergenic
1124279459 15:28350555-28350577 CAGGAACAGGAAGAGAAGATGGG - Intergenic
1124279486 15:28350723-28350745 CAGGAACAGGAAGAGAAGATGGG - Intergenic
1124279515 15:28350909-28350931 CAGGAACAGGAAGAGAAGATGGG - Intergenic
1124303183 15:28560699-28560721 CAGGAACAGGAAGAGAAGATGGG + Intergenic
1124303212 15:28560885-28560907 CAGGAACAGGAAGAGAAGATGGG + Intergenic
1124303239 15:28561053-28561075 CAGGAACAGGAAGAGAAGATGGG + Intergenic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1126843993 15:52742394-52742416 AAGGAACGGAAAGAGGAGTCGGG - Intergenic
1127044642 15:55012802-55012824 CAGGAAGAAAATGAGAAGCTAGG - Intergenic
1127558857 15:60115671-60115693 CAGGAACAAAATTGGGTGTTTGG - Intergenic
1127560398 15:60130677-60130699 CAGAAACAGAATAAGCAGTAGGG + Intergenic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128258728 15:66217031-66217053 AAGGAGCAGAAAGAGAAGTTGGG - Intronic
1128427660 15:67558659-67558681 CTAGAACAGAATGAGAGGTTTGG - Intronic
1129535779 15:76312600-76312622 CAGAAACAGAAAGACCAGTTAGG - Intergenic
1129607698 15:77032805-77032827 CAGGGCCAGAATGGGGTGTTGGG + Intronic
1130781286 15:87043296-87043318 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1130945724 15:88549563-88549585 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1130964159 15:88685030-88685052 CAGGAACACAAGGAAGAGATGGG + Intergenic
1130989186 15:88865720-88865742 CTGGAACTGATAGAGGAGTTGGG - Intronic
1131277181 15:90991975-90991997 CAGGAATAGAATGAGCACTGAGG - Intronic
1132092524 15:98957728-98957750 CAGGGACAGAGTGAGGAGACTGG - Exonic
1132263237 15:100443938-100443960 AAGGAACGGAAAGAGGAGTGGGG - Intronic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1135063742 16:19291942-19291964 AAGGACCAGAATGGGGAGGTGGG + Intronic
1135540637 16:23327583-23327605 CAGGCACACAATGAGGTATTGGG - Intronic
1136753752 16:32665764-32665786 CAGAAACAGAATAAGCTGTTGGG + Intergenic
1136814360 16:33204601-33204623 CAGAAACAGAATAAGCTGTTGGG - Intronic
1136820836 16:33314681-33314703 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136827399 16:33371220-33371242 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136832465 16:33469991-33470013 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1137363657 16:47842213-47842235 AAGGAACAGAAAGGGGAGTGGGG - Intergenic
1138590047 16:57994876-57994898 AAGGAAAAGAATTAGCAGTTGGG + Exonic
1140296543 16:73714545-73714567 CAGGAAGAGAATCGGGAGATGGG - Intergenic
1140801102 16:78489206-78489228 CAGGATGATAATGAAGAGTTAGG + Intronic
1140953829 16:79844499-79844521 CAGGACCCAAATGAGGAATTTGG - Intergenic
1141578474 16:84981162-84981184 CAGGAGCAGAAAAAGGAGTCAGG + Intronic
1142279536 16:89140499-89140521 CAGCAACAGAATGTGAAGCTTGG - Intronic
1202992936 16_KI270728v1_random:27575-27597 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1143592443 17:7893788-7893810 CTGGACCTGAATGAGGAGTCGGG - Exonic
1143726924 17:8854509-8854531 ATGGAACAGAACGAAGAGTTCGG + Intronic
1144189056 17:12826613-12826635 CAGGGCCAGGATGAGAAGTTTGG - Intronic
1144832551 17:18139800-18139822 CAGGATCAGGATGAGGCGCTAGG - Intronic
1145075096 17:19847002-19847024 CATGAAGGGAATGAGGAATTTGG + Intronic
1146501640 17:33369860-33369882 AAGGAACACAATGAGGTATTTGG + Intronic
1146628816 17:34455483-34455505 GAGCTACAGAGTGAGGAGTTGGG + Intergenic
1147794720 17:43034235-43034257 GGGGAAGAGAATGTGGAGTTGGG - Intergenic
1147898547 17:43768641-43768663 CAAGAACAGAAGGAGGAAGTTGG - Exonic
1148026236 17:44589694-44589716 TAGGAACAGCATGAGGAGCCTGG - Intergenic
1149584789 17:57778711-57778733 GTGGAACAGAATGAGGATATGGG + Intergenic
1150732819 17:67710618-67710640 CAGGACCAGAATGAGGAATGAGG - Intergenic
1150759812 17:67951400-67951422 CAGGACCACAAAGAGGAGATTGG + Intronic
1151259590 17:72906111-72906133 AAGGGCCAGAATGAGGAGTCTGG + Intronic
1151388468 17:73769970-73769992 CTGGAATAGAATGAGGCGATGGG + Intergenic
1151817949 17:76480748-76480770 GAGGGACTGGATGAGGAGTTAGG - Intronic
1152100850 17:78301082-78301104 CAGGAACAGGATGAGGTGAAGGG - Intergenic
1152519700 17:80848050-80848072 CAGCCAGAGAAAGAGGAGTTGGG + Intronic
1152881938 17:82822567-82822589 CAGGAACACAGTGAGGGGTTTGG + Intronic
1153614059 18:6917964-6917986 ATGGAAGAGAATCAGGAGTTGGG + Intergenic
1155831405 18:30519326-30519348 TCTGAACAGAATGAGGAGTAAGG + Intergenic
1156251712 18:35358391-35358413 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1156637474 18:39048894-39048916 CAGGAAGGGAATGAGGGGTGGGG + Intergenic
1156869494 18:41929101-41929123 CAGGAAGAGCTAGAGGAGTTGGG + Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157284040 18:46364999-46365021 CAGGAGAAGAGTGAGGGGTTGGG + Intronic
1158617984 18:59005433-59005455 CTGGGACAGAATGAGGAGGGAGG + Intergenic
1160113703 18:76057631-76057653 CTGGAAACGAATGAGGAATTCGG - Intergenic
1161712375 19:5856232-5856254 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1162855866 19:13468201-13468223 CGGGAAGAGAGTGAGGAGTGAGG + Intronic
1163418815 19:17202815-17202837 GAGGAACACAAGGAGGAGGTTGG - Intronic
1164220250 19:23186892-23186914 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1166602428 19:44109417-44109439 CAGGAAGAGAAAATGGAGTTTGG + Exonic
1166755090 19:45185716-45185738 CAGGGCCAGAATGAGGAGCAGGG + Intronic
1166926911 19:46275397-46275419 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1167853570 19:52220263-52220285 CAGGAGCAGCAAGAGGAGATGGG + Intronic
1168128990 19:54305412-54305434 CAGGGACAGAAGGAGTAGGTGGG + Intergenic
925746794 2:7050556-7050578 CAGGAACAGAATGGTGAGAAGGG - Intronic
925758321 2:7156759-7156781 GAGGGACAGAATGAGGAGAGGGG - Intergenic
927002467 2:18812429-18812451 CAGGAATAGATGGAGGATTTGGG + Intergenic
928827437 2:35439162-35439184 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
929108239 2:38384900-38384922 CAGGAACAGATTTAGTATTTTGG + Intergenic
929383794 2:41381743-41381765 GAGGAACAGAAAGAGGAGTGGGG - Intergenic
929464041 2:42128892-42128914 TAGGAACAGAATGCGTGGTTAGG - Intergenic
929536602 2:42788003-42788025 CTGGAGCTGAAGGAGGAGTTGGG - Intronic
931218576 2:60268369-60268391 CAGTTGCAAAATGAGGAGTTTGG + Intergenic
931967554 2:67550222-67550244 CAGGAACAGAGTAAGTAATTTGG + Intergenic
932741008 2:74291129-74291151 CAGGAAGTGTATCAGGAGTTTGG - Intronic
933263297 2:80153575-80153597 CAGGAAAAGAAGGAGCAGTGAGG - Intronic
933448840 2:82419576-82419598 CATTAACAGAATGAGGAGGTGGG - Intergenic
934847839 2:97673778-97673800 CAGAAACAGTATGAGGTGCTGGG - Intergenic
936092653 2:109511170-109511192 CAAGAACAGGCTGAGGAGTTAGG - Intergenic
936604192 2:113932339-113932361 TATGAATAAAATGAGGAGTTGGG + Intronic
936779814 2:116018525-116018547 AAGGAGCAGAATGATGAGTTGGG + Intergenic
937243934 2:120480196-120480218 TAGGGACAGAAAAAGGAGTTTGG - Intergenic
937998786 2:127715599-127715621 CAGGAACACACTGAGAAGTGAGG - Intronic
938604264 2:132876020-132876042 GAGGAACATATTGAGGATTTGGG - Intronic
938760108 2:134417367-134417389 CAGGAACAGAAAAAGGATCTCGG - Intronic
939172256 2:138709693-138709715 CAGTAAAAGAATTAGGGGTTGGG - Intronic
939978341 2:148747344-148747366 CAGGTACACAAGGAAGAGTTAGG - Intronic
940065600 2:149624494-149624516 TAGCAATAGAATGAGAAGTTAGG + Intergenic
940150404 2:150594172-150594194 CAAGAACAGAATAAGGAAATTGG + Intergenic
940183946 2:150962117-150962139 AAGGAACAGAAAGGGGAGTGGGG - Intergenic
941439409 2:165514700-165514722 AAGGAGCAGGAGGAGGAGTTGGG - Intronic
941455948 2:165712397-165712419 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
941644058 2:168021065-168021087 CAGGAAAAAAATGAGGAATTTGG + Intronic
941892801 2:170599154-170599176 TAGGAACACAATGAGGAGTGAGG - Intronic
943201658 2:184835021-184835043 CAGGCACAGAACTAGGTGTTAGG + Intronic
943450357 2:188036876-188036898 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
943644885 2:190399598-190399620 CAGGAACAGAAAAAGGATATTGG + Intergenic
943951078 2:194132949-194132971 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
944417417 2:199492736-199492758 AGGGAACAAAGTGAGGAGTTGGG + Intergenic
945173698 2:207021054-207021076 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
945224006 2:207513643-207513665 CAGGCATAGAAAGAGAAGTTGGG + Intergenic
945858373 2:215093397-215093419 AAGGAACAGAAAGGGGAGTGGGG - Intronic
946284295 2:218691459-218691481 TATGAATAGAATGGGGAGTTTGG + Intronic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
947818118 2:233051674-233051696 GAGGAACAGAACGTGGAGCTGGG + Intergenic
948038307 2:234877915-234877937 CTGGAACAGATTGATGAATTTGG - Intergenic
948583224 2:239002450-239002472 CAGGGAGAGAAGGAGGAGTGTGG - Intergenic
948584019 2:239007366-239007388 CAGGGACAGAAAGAGGAATGAGG - Intergenic
948657872 2:239487729-239487751 CAGGAAGAGAAAGAGGAGAGGGG - Intergenic
948838298 2:240636793-240636815 CAGGAACAGAAGGGGGAGGGTGG - Intergenic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
1169284366 20:4295532-4295554 CAGGCACAGCATGAGGACCTGGG - Intergenic
1170680215 20:18519663-18519685 AAGGAACGGAAAGAGGAGTGGGG + Intronic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172951779 20:38727076-38727098 CAGGAACAGAATGAGGAGTTGGG - Intronic
1172977085 20:38914251-38914273 GAGGAAAAGAATGAGAATTTGGG + Intronic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173462570 20:43255269-43255291 CATGAACAAAATGGGGATTTTGG - Intergenic
1173652291 20:44674173-44674195 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1173763560 20:45586269-45586291 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1173919125 20:46730868-46730890 CAGAAACAGAATGGGCAGTCAGG - Intronic
1174499760 20:50975967-50975989 CAGGAATAGACTGGGAAGTTGGG - Intergenic
1175622062 20:60456058-60456080 CAGTAAAAGAATGAGATGTTAGG + Intergenic
1175655770 20:60769114-60769136 GAGGAAGGGAATGAGGAGTTAGG - Intergenic
1175768701 20:61609023-61609045 CAGGAAAAGATGGAGGAGCTGGG - Intronic
1177306476 21:19324678-19324700 CAGAGAGAGAATGAGGAATTGGG + Intergenic
1177679083 21:24340800-24340822 AAGGAACAGTATGATAAGTTTGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180587129 22:16902745-16902767 CAGGAACAGAATATTAAGTTTGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182025948 22:27119472-27119494 CAGGAACAGAATCAAGACTTAGG - Intergenic
1183281667 22:36935751-36935773 CAGGAAGGGAAGGAGGAGGTGGG - Intronic
1183454134 22:37912289-37912311 CAGGAAGAGGAGGAGGCGTTAGG - Intronic
1183635407 22:39059373-39059395 AAGGAACGGAAAGAGGAGTAGGG + Intronic
1183832325 22:40424916-40424938 CAGGAACAGACTAAGGAGCCTGG + Intronic
1183969318 22:41464565-41464587 CAGGGACAGAATGAGGCATGAGG + Intronic
1184357799 22:43994256-43994278 CAGGAACAGAAGGGGGAGTGGGG + Intronic
1184633999 22:45811755-45811777 CAGAAACTGAAAGATGAGTTAGG - Intronic
1185103781 22:48855868-48855890 CAGGGACAGTCTGAGGACTTGGG + Intergenic
949326170 3:2867170-2867192 CAGGAATAGAATGAGGATTTAGG + Intronic
949366438 3:3286411-3286433 CACGAACAGAAAGGGGAATTGGG + Intergenic
950168413 3:10818700-10818722 GAGGGACAGAATGAGGGATTTGG + Intronic
950225111 3:11227079-11227101 CAGGAGCAGAAAGACCAGTTAGG + Intronic
951129741 3:19028175-19028197 CAAGAACAGAAAAAGGAGCTGGG + Intergenic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951830869 3:26925606-26925628 CAGGAGCAGAGTGAGAAGTGGGG - Intergenic
951848536 3:27112079-27112101 CAGGAACAGAAAGAGCAGCAAGG - Intronic
951848718 3:27114241-27114263 CAGGAACAGAAAGAGCAGCAAGG - Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952222899 3:31342353-31342375 CAGGGAAAGAATGATGAATTTGG + Intergenic
952894975 3:38072564-38072586 AAGGAACAGAAAGAGGAGTGGGG + Intronic
953656312 3:44857579-44857601 AAGGAACGGAAAGAGGAGTGGGG + Intronic
953834241 3:46329403-46329425 AAGGAACATAAAGAGGAGTGGGG + Intergenic
954004587 3:47580628-47580650 CAGGAAGGGAAGGAGGAGGTAGG - Exonic
954043742 3:47911062-47911084 CAGGATAAGAGTGAGGAGCTGGG - Intronic
954096465 3:48332565-48332587 CAGAATCAGAATGTGGAGATTGG - Intergenic
954240852 3:49292368-49292390 CAGCAGCAGAGTTAGGAGTTAGG - Intronic
955503945 3:59612599-59612621 CAGGCACAGAAAAAGGAGATGGG - Intergenic
956140072 3:66137733-66137755 TAGGAACTGTATTAGGAGTTGGG - Intronic
956233281 3:67040755-67040777 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956324204 3:68032945-68032967 AAGGAAGAGAATGAGGAATTGGG - Intronic
956364431 3:68484597-68484619 CAGAAGCAGAATGAGGAGTTTGG + Intronic
956448713 3:69351814-69351836 CAGTAACAGAATGAGGAGATTGG + Intronic
956709436 3:72026637-72026659 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
957059698 3:75472138-75472160 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
957559701 3:81806937-81806959 CAAGAAAAGAATGAAGAATTGGG - Intergenic
959102263 3:102024409-102024431 CAGGCACAAAATGAGTAGCTGGG - Intergenic
959129829 3:102340559-102340581 CAAGAACAGGAAGAGGAATTTGG + Intronic
960657467 3:120021546-120021568 TAGGAACAGGAACAGGAGTTTGG + Intronic
960682319 3:120262385-120262407 TAGGAACAGAATGTTGAGTCAGG + Intronic
960729472 3:120710272-120710294 CAGCAACCGAATGTGGAGCTCGG + Intronic
960764932 3:121115822-121115844 CAGGAGCAAGAGGAGGAGTTAGG + Intronic
961211109 3:125126584-125126606 CAGGAACAGAAAAGGGAATTGGG - Intronic
961293707 3:125867241-125867263 AAGGAACTGAAAGAGGAGTGGGG - Intergenic
963402443 3:144817107-144817129 CAGGAAGTGAATGGTGAGTTAGG + Intergenic
963521842 3:146365703-146365725 AAGGAATGGAAAGAGGAGTTGGG - Intergenic
964914305 3:161820861-161820883 TAGGGACAGAATGATGAGTGTGG + Intergenic
965624642 3:170674426-170674448 AAGGAACGGAAAGAGGAGTGGGG + Intronic
965639790 3:170819859-170819881 AAGGAACAGAAAGAGGAGTGGGG + Intronic
965861767 3:173158021-173158043 AAGGAACAGAAAGAGGAATGGGG + Intergenic
965949962 3:174296957-174296979 TAGGAAGAGAATAAGGAATTGGG - Intergenic
966970446 3:185040638-185040660 CAGAAACAGAATGTAGAGTAAGG - Intronic
967154502 3:186680189-186680211 CTGGAGAAGAATGAAGAGTTTGG - Intergenic
967194478 3:187014573-187014595 CAAGCACAGAATGTGGACTTAGG - Intronic
967245786 3:187485052-187485074 CAGGAACAGAAGGAACAGTGTGG + Intergenic
969003605 4:4002324-4002346 AAGGAACAGAAAGAGGGGTGGGG + Intergenic
969144465 4:5109487-5109509 CATGAACAGAATTAGGAGCAAGG + Intronic
969636594 4:8373022-8373044 CCGGATCAGAATGTGGGGTTGGG + Intronic
969653834 4:8484682-8484704 AAGGAACAGAAAGAGGAGTGGGG + Intronic
969749255 4:9097862-9097884 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
969810319 4:9642499-9642521 AAGGAACAGAAAGAGGGGTGGGG - Intergenic
970554505 4:17217618-17217640 TAGGAACAAAAGGGGGAGTTTGG - Intergenic
970797797 4:19935067-19935089 AAGGAAGGGAATGAGGAGTTAGG + Intergenic
970971543 4:21989927-21989949 GAGGAGGAGAAGGAGGAGTTGGG - Intergenic
971196444 4:24474944-24474966 CAGGAACAGAATGTTAACTTGGG - Intergenic
971229556 4:24789951-24789973 CAGGAACACTATGAGGAGGTGGG + Intronic
973291287 4:48473390-48473412 AAGGCACTGAAGGAGGAGTTAGG + Intergenic
973823644 4:54684538-54684560 AAGGCTCAGAATGAAGAGTTGGG - Intronic
975583832 4:75930725-75930747 CAGGGCCACAATGAAGAGTTTGG - Intronic
976954519 4:90879388-90879410 CAGGAATAGAATTTGGAATTTGG - Intronic
978712023 4:111794734-111794756 CAATAAAAGTATGAGGAGTTAGG - Intergenic
978905083 4:113996051-113996073 AAAGAAGAGAATGAGGAGTGGGG + Intergenic
979055447 4:115987492-115987514 CAGGAACAGAACCAGTAGTGAGG + Intergenic
979171189 4:117602378-117602400 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
980505332 4:133711893-133711915 CAGGAACAGCTACAGGAGTTAGG - Intergenic
982319059 4:154060085-154060107 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
983345775 4:166524172-166524194 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
983666377 4:170188978-170189000 CATGAACAGAATGATGGGTTTGG + Intergenic
983801797 4:171940433-171940455 CAAGAACATAATGGGGAGTTTGG + Intronic
983883543 4:172958431-172958453 AAGGAACAGAAAGAGGAGTGGGG + Intronic
985003732 4:185512054-185512076 CAGGAAGAGAAGGAGGATGTTGG + Intronic
985435930 4:189929501-189929523 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
985592782 5:774127-774149 CAGGAACAGCCTGTGGGGTTGGG - Intergenic
986368732 5:7060211-7060233 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
986554829 5:9000609-9000631 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
987248341 5:16073117-16073139 CAGGAAGCAAATGAGGACTTTGG + Intronic
988895665 5:35671056-35671078 CAGCAATGGAATGAGGAGTGAGG + Intronic
988968688 5:36444716-36444738 CAGTAAGAGAATGAGGAAGTGGG - Intergenic
989079071 5:37597088-37597110 CATTAACAGAATGAAGATTTGGG + Intronic
989760053 5:45004075-45004097 AAGAAAAATAATGAGGAGTTTGG - Intergenic
991134338 5:63163613-63163635 CAGGAATAGAATCAGGAAGTAGG - Intergenic
991358750 5:65797959-65797981 CAGTAACAGAAAGAGCAGCTTGG + Intronic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
992961052 5:81956930-81956952 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
994325129 5:98438372-98438394 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
995087811 5:108135354-108135376 CAGGAACAGAAACAGCACTTGGG - Intronic
995888387 5:116921549-116921571 CAGGAGCAGCATGAGCAGTCAGG - Intergenic
996365018 5:122692059-122692081 GAGTAAAAGAATGAGGACTTTGG - Intergenic
997271980 5:132547565-132547587 CAGGAACAGAATAAGGACAACGG + Intronic
997492585 5:134290530-134290552 CTGGAACAGAATGAGCAATAGGG + Intronic
998358033 5:141557910-141557932 CAGGAATAAAAAAAGGAGTTAGG - Intronic
998693483 5:144613416-144613438 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
999865732 5:155698563-155698585 AAGGAACAGAATTAGGAGATTGG + Intergenic
999872858 5:155770463-155770485 AAGGATCTGAAAGAGGAGTTTGG + Intergenic
1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG + Intronic
1000626826 5:163548200-163548222 CAGGTAGAAAATGCGGAGTTTGG - Intergenic
1000810507 5:165855639-165855661 GAGGAAAAGAATGAGGACTTTGG - Intergenic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1000961548 5:167606719-167606741 CACTAACAGGATGAAGAGTTAGG - Intronic
1001082386 5:168676898-168676920 CAGGAAGGGAAGAAGGAGTTGGG - Intronic
1001354051 5:171003289-171003311 AAGGAACAGAAAGAGGAGTGGGG + Intronic
1002307443 5:178292181-178292203 CAGGAACAGATCGAGGAGGAGGG - Intronic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1003143632 6:3491965-3491987 GAGAAAGAGAAAGAGGAGTTTGG - Intergenic
1004837222 6:19542550-19542572 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1005075928 6:21907476-21907498 CTGGAACATAATGCGGAGATAGG + Intergenic
1005485680 6:26297070-26297092 CAGGAACAGAATGAACCATTAGG + Intergenic
1006017539 6:31094288-31094310 CAGGCAGAGAAAGAGGAGGTGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007490893 6:42221037-42221059 CAGGAACAGAGTTGGGAGTGGGG - Intergenic
1007581465 6:42962731-42962753 CAGGAAGAGAAAGAGGAATCAGG - Intronic
1008585948 6:52949239-52949261 CAGAAACAGAAAGAAAAGTTTGG + Intergenic
1010106969 6:72181644-72181666 CAGGAAAGCAATGAGGAATTGGG + Intronic
1010181286 6:73089285-73089307 GATGAACAGAATAAGGATTTAGG + Intronic
1011112145 6:83850488-83850510 CAGGAAAAAAATAATGAGTTTGG - Intergenic
1013112997 6:107079179-107079201 CAGCAAAACAATGTGGAGTTTGG + Intronic
1013383046 6:109596423-109596445 TAGGATGAGGATGAGGAGTTTGG - Intronic
1013817088 6:114111626-114111648 CAGAAACAGAATGTGAAGCTGGG + Intronic
1014740547 6:125143651-125143673 TAGGCACAGGATGGGGAGTTGGG + Intronic
1015732024 6:136358839-136358861 AAGGAGCAGAATCAGGAGCTGGG + Intronic
1015801164 6:137063388-137063410 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1016204747 6:141456460-141456482 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1016249084 6:142019454-142019476 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1016668291 6:146670383-146670405 CAGAAACAGAAAGAAGACTTGGG - Intronic
1016700438 6:147048352-147048374 AAGGGAAAGAATGAGGAGTGAGG - Intergenic
1017413860 6:154198882-154198904 CAGTGAAAGAATGATGAGTTTGG - Intronic
1017870272 6:158481022-158481044 CAGGAAGAAAATGAAGAGCTGGG - Intronic
1017992355 6:159502636-159502658 CAGAATCAGGATGTGGAGTTTGG - Intergenic
1018991725 6:168678891-168678913 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1019647179 7:2137201-2137223 CAGGAAGAGAATAGGGAGATGGG - Intronic
1019747646 7:2709543-2709565 CAGGACCAAAATGAGGACCTGGG - Intronic
1020323740 7:6958778-6958800 AAGGAACAGAAAGGGGAGTGGGG + Intergenic
1020334788 7:7054654-7054676 CAGGAAGAGAATCAGGAGAGTGG + Intergenic
1020410220 7:7884006-7884028 CAGGAAGAGAATGAGTATTTAGG - Intronic
1020794448 7:12663346-12663368 AAGGAACAGAAAGAGGAATGGGG - Intergenic
1021124446 7:16834980-16835002 AAGGAACAGAAAGAGATGTTGGG - Intergenic
1021331866 7:19348046-19348068 CAGGAAAAGAATGAAAAGTTTGG + Intergenic
1022447627 7:30482878-30482900 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1022572572 7:31469097-31469119 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1022612196 7:31887006-31887028 GAGGAACAGAATGATGAGATTGG + Intronic
1022964514 7:35460081-35460103 CAGGAAAAGAATCAGGTGATGGG - Intergenic
1023346015 7:39271958-39271980 TATGAAGAGGATGAGGAGTTGGG + Intronic
1023375430 7:39550908-39550930 TTGGAACAGGATGAGGACTTAGG - Intergenic
1023670451 7:42570850-42570872 CAGGAAGAGTATGAAGAGTGAGG + Intergenic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024185047 7:46940830-46940852 CAGGATGAGAATGGGGGGTTAGG + Intergenic
1024532858 7:50407520-50407542 CAGGCACAGAGTGAGGAGGTGGG + Intergenic
1024929044 7:54650565-54650587 CAGGAGCAGAAAGAGGAGAAAGG - Intergenic
1026374559 7:69737595-69737617 CAGGAGCAGACTGGGGACTTAGG - Intronic
1026916255 7:74121773-74121795 CAGGAACCAAATGGGGAGTCTGG + Exonic
1028184491 7:87767113-87767135 CAGGACCTGAAAGATGAGTTAGG - Intronic
1028393527 7:90341715-90341737 CAGTAACCAAATGAGGAATTCGG + Intronic
1029109997 7:98208900-98208922 CAGGAATAAAAGGAGGGGTTTGG - Exonic
1029260106 7:99296413-99296435 CAGGTGTAAAATGAGGAGTTTGG - Intergenic
1030441472 7:109594098-109594120 AAGGAACGGAATGAGGCGTGGGG + Intergenic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1031422228 7:121565887-121565909 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1031561784 7:123247887-123247909 CAGGAATAGAATGAGAATGTAGG - Intergenic
1032836706 7:135681756-135681778 CAGGAACAGAAGGGGGACTTGGG - Intronic
1033084890 7:138332301-138332323 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1033147719 7:138885368-138885390 TATGAGCAGAATGAGGTGTTTGG - Intronic
1034445191 7:151110511-151110533 CTGGAACAGAATAAGGGGATTGG + Intronic
1035880453 8:3240281-3240303 AAGGAACGGAAAGAGGAGTGGGG + Intronic
1035938993 8:3875110-3875132 CAGGAACACATTGTGGGGTTTGG + Intronic
1036372322 8:8172206-8172228 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1036878580 8:12493435-12493457 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1037846015 8:22282945-22282967 CAGGAAGAGATTGTGGAGTTGGG + Intronic
1038664666 8:29527801-29527823 CATGAACAGAATCAGGAATGGGG + Intergenic
1040430341 8:47335028-47335050 CAGGAACAGAAGGAGAAATTAGG - Intronic
1041651623 8:60308559-60308581 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1041779400 8:61561016-61561038 AAGGAAGGGAATGAGGAGTAAGG + Intronic
1042319201 8:67457347-67457369 CAGGAAAAAAATGAGAATTTTGG - Intronic
1042448584 8:68918622-68918644 CAGGAACTGAATGGTGATTTGGG + Intergenic
1043599072 8:81917090-81917112 AAGGAATAGAAAGAGGAGTGGGG - Intergenic
1043799814 8:84594106-84594128 TATGAACTGAATGAGGATTTAGG - Intronic
1044359819 8:91269955-91269977 CAGGAAGAAAATGAGAAATTTGG - Intronic
1045135148 8:99208928-99208950 AAATAACAGAATGAGAAGTTGGG + Intronic
1047306332 8:123655811-123655833 CTGGAACAGAATGGGGAATGGGG + Intergenic
1047386934 8:124418453-124418475 CAGCATCAGAATGAGAAATTTGG + Intergenic
1048293711 8:133199183-133199205 CAAGGACAGAACGAGGAGTCAGG + Intronic
1048462346 8:134631772-134631794 CAGTATCAGAATCAGGACTTTGG - Intronic
1049097447 8:140557409-140557431 CAGAAACAAAATGAGAATTTAGG - Intronic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050117831 9:2279207-2279229 AAGGAACGGAAAGAGGAGTGGGG - Intergenic
1050990139 9:12139749-12139771 AAGGAAAAAAATGAGGAGGTGGG + Intergenic
1051761724 9:20474471-20474493 TAGGAACAGAATGACAAGATAGG - Intronic
1052189553 9:25642726-25642748 CATGTATAGTATGAGGAGTTTGG + Intergenic
1052282515 9:26748992-26749014 GAGAGACAGAATGAGGAGGTTGG - Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1054807266 9:69406816-69406838 AAGGAACGGAAAGAGGAGTGGGG + Intergenic
1054966875 9:71038814-71038836 TAGTTACAGAATGAGGAGTGGGG + Intronic
1055144080 9:72911823-72911845 CAAGAACAGAATAAAGAGTAAGG + Intronic
1057879540 9:98782780-98782802 CAGGAACAAAATGAAGACTGAGG + Intronic
1058612617 9:106791990-106792012 AAGGAACAGAAAGAGGAGTAGGG - Intergenic
1059054670 9:110966826-110966848 CAGTACCAGAGTGAGCAGTTTGG - Intronic
1059306843 9:113360479-113360501 GAGGGATAAAATGAGGAGTTGGG - Intronic
1185854935 X:3525016-3525038 CTGGAACAGAAAGAGGATATTGG - Intergenic
1186788161 X:12972472-12972494 CAGGAAGAGTGTGAGGAGCTAGG - Intergenic
1187175749 X:16894990-16895012 AAGGAAGAGAAGGAGGAGTGGGG - Intergenic
1187454459 X:19429041-19429063 CAGGAACAGAGACAGGAGTTTGG + Intronic
1187613413 X:20967557-20967579 CAGGAACAGCATGGGGAATAAGG - Intergenic
1188201118 X:27293679-27293701 CAGGGAAAGAAGGAGGATTTGGG + Intergenic
1188442795 X:30229845-30229867 GAGGAACAGAATGAAGAGTGTGG - Intergenic
1188779899 X:34268906-34268928 CAGGAATAGAACCAGGAGTGAGG - Intergenic
1189083963 X:38000867-38000889 CAGCAAAACAATGCGGAGTTCGG - Intronic
1189170954 X:38908902-38908924 CAGGCAAAGAATGAGGACATAGG + Intergenic
1189417750 X:40830082-40830104 CAGGCACATCATTAGGAGTTTGG - Intergenic
1191215684 X:57930438-57930460 AAGGAAGAGAACCAGGAGTTAGG - Intergenic
1191851445 X:65588846-65588868 TAAGAACAGAGTGGGGAGTTGGG - Intronic
1191925275 X:66302366-66302388 CGGGGAGAGAAAGAGGAGTTGGG - Intergenic
1191934448 X:66411351-66411373 CAGGACCAGTAAAAGGAGTTGGG - Intergenic
1192432679 X:71123062-71123084 AAGGAAGAGAAGGAGGAGTAAGG - Intronic
1193398604 X:81014710-81014732 GAGGAACAGCATGTGGTGTTTGG - Intergenic
1194658795 X:96605259-96605281 TACGAACAGAAAGAAGAGTTAGG + Intergenic
1194873577 X:99161496-99161518 AAGGAACAGAAAGAGGAGTGGGG + Intergenic
1195404507 X:104497845-104497867 AAGGAAGAGATTGAGGAATTTGG + Intergenic
1195571857 X:106406027-106406049 TAGGAACAAAGTGAGCAGTTAGG + Intergenic
1196009660 X:110873183-110873205 CAGGAACAGAAAGAAGAGGCAGG - Intergenic
1197499931 X:127230237-127230259 AAGGAACAGAAAGAGGAGTGGGG - Intergenic
1198011524 X:132561030-132561052 AAGGAACAGAATGAGGTGGAAGG - Intergenic
1198053785 X:132974479-132974501 CAAGAACAGAATGGAGAGATGGG - Intergenic
1198435059 X:136609080-136609102 CAGGTACTGGCTGAGGAGTTTGG + Intergenic
1199095797 X:143736814-143736836 CATGAACAAAATGAAAAGTTTGG + Intergenic
1199339580 X:146661128-146661150 CAGCAACAGACTGAGGAATATGG + Intergenic
1200171195 X:154076370-154076392 CAGGAGCTGAACGAGGGGTTAGG - Intronic
1200293312 X:154892511-154892533 AAGGAAGAAAATGAGCAGTTAGG - Intronic
1201509639 Y:14744795-14744817 CAGAAACAGACAGATGAGTTAGG - Intronic
1201609375 Y:15823676-15823698 CAGGCACAGAATGGGGAGGTGGG + Intergenic
1201742945 Y:17343260-17343282 CAGGAAGAGAAGGAAGAGTCTGG + Intergenic
1202076298 Y:21040986-21041008 AAGGAACAGAAAGAGGAGTGGGG + Intergenic