ID: 1172952545

View in Genome Browser
Species Human (GRCh38)
Location 20:38731161-38731183
Sequence CCAGGGTTTCGGGTTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172952545_1172952553 -1 Left 1172952545 20:38731161-38731183 CCAAGGGAAACCCGAAACCCTGG No data
Right 1172952553 20:38731183-38731205 GTCGGTAGGACACCGATACCCGG No data
1172952545_1172952559 30 Left 1172952545 20:38731161-38731183 CCAAGGGAAACCCGAAACCCTGG No data
Right 1172952559 20:38731214-38731236 CCAGGCTACTGAGAGAAATAAGG No data
1172952545_1172952555 12 Left 1172952545 20:38731161-38731183 CCAAGGGAAACCCGAAACCCTGG No data
Right 1172952555 20:38731196-38731218 CGATACCCGGACTCGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172952545 Original CRISPR CCAGGGTTTCGGGTTTCCCT TGG (reversed) Intergenic