ID: 1172954978

View in Genome Browser
Species Human (GRCh38)
Location 20:38749734-38749756
Sequence CATTAGAAGCAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172954972_1172954978 27 Left 1172954972 20:38749684-38749706 CCCAGGTAAGGGATGATGGTGGC 0: 1
1: 1
2: 18
3: 66
4: 289
Right 1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG 0: 1
1: 0
2: 2
3: 20
4: 192
1172954973_1172954978 26 Left 1172954973 20:38749685-38749707 CCAGGTAAGGGATGATGGTGGCT 0: 1
1: 3
2: 64
3: 221
4: 715
Right 1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG 0: 1
1: 0
2: 2
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172954978 Original CRISPR CATTAGAAGCAGTTGGATTC TGG Intronic
901147329 1:7074463-7074485 CATTAACAGCAGTTGGATTTGGG - Intronic
901479948 1:9518390-9518412 CATTAGAAGCATTTTGTTCCTGG - Intergenic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
904498241 1:30899668-30899690 CATTAGAAGTGGGTGGATTTTGG - Intronic
905822567 1:41005034-41005056 CATGAGAATCACTTGAATTCTGG + Intronic
906349562 1:45046348-45046370 GATGAGCAGTAGTTGGATTCTGG + Intronic
908774362 1:67625943-67625965 GGTGAGAAGCAGTTGAATTCCGG - Intergenic
909372893 1:74906863-74906885 CATTATATGCTGTTGGCTTCAGG - Intergenic
910129802 1:83889985-83890007 CTTTAGCAGCACTAGGATTCTGG + Intronic
915856512 1:159393274-159393296 CAGGAGAAGCACTTGGACTCAGG + Intergenic
916149663 1:161774378-161774400 AATGAGAAGTAGTTGGATTATGG + Intronic
917125741 1:171686011-171686033 CTTTAGAAACAGTTGGCTACAGG + Intergenic
917163448 1:172083762-172083784 CCTTAGAAGCTGTTGGACTATGG + Intronic
917184002 1:172331942-172331964 AGTGAGAAGCAGTTGGATTCAGG + Intronic
917686999 1:177426561-177426583 AAGTAGAAGCATTTGCATTCTGG - Intergenic
918464474 1:184807451-184807473 TATTAGAAACAGTAGGAATCAGG + Intronic
919161453 1:193835806-193835828 CAGGAGAAGCACTTGGATCCGGG + Intergenic
922515294 1:226203474-226203496 CATTTGCAGCAGATGTATTCAGG - Intergenic
922534736 1:226371474-226371496 TATTAGAAGCTGTTGGCTCCTGG - Intronic
923096699 1:230780729-230780751 CACTAAAAGAAGTGGGATTCTGG - Intronic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1066253025 10:33652536-33652558 CCTTAAAAACAGTTGAATTCTGG - Intergenic
1068548343 10:58378186-58378208 CATTAGAACCAGTAGTAGTCTGG - Intergenic
1069104137 10:64361747-64361769 CATAAGAATCACTTGAATTCAGG + Intergenic
1069305842 10:66968532-66968554 GGTTAGAAGCGATTGGATTCAGG + Intronic
1069546380 10:69332209-69332231 CATTTAAAGCAGTGGGTTTCTGG + Intronic
1069576866 10:69536889-69536911 CATGAGAATCACTTGAATTCAGG + Intergenic
1069903399 10:71718661-71718683 CATTAGAACTAGTAGGATTGAGG - Intronic
1072098240 10:92203998-92204020 CATCAGAAGCAGTGGGAGACAGG - Intronic
1075219947 10:120576232-120576254 CATTCAAAGAAGCTGGATTCAGG - Intronic
1076224836 10:128765608-128765630 CATTAGAAGAAATTGGATGAAGG + Intergenic
1079519492 11:21309158-21309180 CATAACAAGCAGTTTGATTCAGG + Intronic
1080048014 11:27829642-27829664 GATGAGAAGTGGTTGGATTCTGG + Intergenic
1080229190 11:29999355-29999377 CATTAGAAGCAGACAGATCCTGG - Intergenic
1086345517 11:85891900-85891922 TATTTGAAGCAGATGGATTTGGG - Intronic
1086351707 11:85948948-85948970 CATTCCAAGCAGCAGGATTCAGG - Intergenic
1093073743 12:14735542-14735564 GGTGAGAAGCAGTTGGATTCTGG - Intergenic
1094127120 12:27034841-27034863 CATAAGAAGCACTTGGACCCGGG - Intronic
1097258339 12:57697403-57697425 GATGGGAAGTAGTTGGATTCTGG + Intronic
1097641390 12:62186967-62186989 CATTAGAAACAGGTGGATTTTGG + Intronic
1097698291 12:62795817-62795839 CATGAGAATCATTTGAATTCCGG - Intronic
1098870573 12:75812824-75812846 CATCAGAAGCACTGGGAATCAGG + Intergenic
1099019590 12:77386920-77386942 CATGAGAAGCAGTTGGAAGAAGG + Intergenic
1099679133 12:85801884-85801906 CATAAGAAGCATTTTTATTCTGG - Exonic
1100407595 12:94284948-94284970 CATTAGAAGCTGTGGATTTCTGG + Intronic
1101139674 12:101782496-101782518 GATAAGAAGTGGTTGGATTCTGG - Intronic
1103770797 12:123322385-123322407 CATTAGAATCACTTGAACTCGGG - Intronic
1107588288 13:41876078-41876100 GATAAGAAGTAGTTGGATTTGGG - Intronic
1107790461 13:43997000-43997022 AATGAGAAGCAGTTGAGTTCGGG + Intergenic
1110328809 13:74248057-74248079 CATCAGAAGCAGGTTGATTGAGG - Intergenic
1113030842 13:105992060-105992082 CATTGTGAGCAGCTGGATTCAGG - Intergenic
1114881754 14:26795046-26795068 TCTGAGAAGCAGTTTGATTCTGG + Intergenic
1118230581 14:63944898-63944920 CATGAGAATCACTTGAATTCAGG - Intronic
1121752178 14:96366065-96366087 AGTTAGAAGCAGTTGGATTCTGG + Intronic
1124926598 15:34076079-34076101 CTTGAGAAGAAGTTGGATTATGG - Intergenic
1125043079 15:35214529-35214551 GATGAGAAGTGGTTGGATTCTGG - Intergenic
1125314294 15:38414655-38414677 CTTTAAAATCAGTTGAATTCAGG + Intergenic
1125699576 15:41670128-41670150 AATGAGAATCAGTTGGGTTCAGG + Intronic
1125782293 15:42280502-42280524 CAGCAGAAGCAGTTGGCTCCAGG + Intronic
1128694000 15:69746936-69746958 CATAATAAACAGTAGGATTCTGG + Intergenic
1128758865 15:70201364-70201386 CATTAGTAGCAGGAGGAATCTGG + Intergenic
1129496625 15:75988481-75988503 CATTAGAAGGAGTTGTAGGCTGG - Intronic
1129636945 15:77330264-77330286 GATGAGAAGTAGTTTGATTCTGG - Intronic
1131518266 15:93094042-93094064 CATTTCCAGCAGTTGGATTTTGG + Intergenic
1134289657 16:12893581-12893603 AATGAGAGGCAGTTGGATTTGGG + Intergenic
1135248035 16:20873984-20874006 CTCTAGGAACAGTTGGATTCAGG - Intronic
1137649522 16:50107978-50108000 CATGAGAATCACTTGGATCCAGG + Intergenic
1140518692 16:75563942-75563964 GATGGGAAGCAGTTGTATTCTGG - Intergenic
1141723929 16:85773697-85773719 CATTTTTAGCAGGTGGATTCAGG - Intronic
1143038558 17:4015669-4015691 CATGAGAATCACTTGAATTCGGG + Intronic
1143849257 17:9797440-9797462 AATTAGAAACAGATGGATCCTGG + Intronic
1144144906 17:12388028-12388050 GATGAGAAGTAGATGGATTCAGG + Intergenic
1144231370 17:13207636-13207658 TATTGGAAGCCATTGGATTCAGG - Intergenic
1147257128 17:39188188-39188210 CATGAGAATCATTTGAATTCAGG + Intronic
1148316778 17:46707938-46707960 CATGAGAATCATTTGGATCCGGG + Intronic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1148944799 17:51251634-51251656 CATAAGGAGCAGTTGGAATTTGG + Intronic
1149895889 17:60427985-60428007 CATTAGAATCCATTGGTTTCAGG + Intronic
1150239254 17:63618910-63618932 GATGAGAAGTGGTTGGATTCAGG + Intergenic
1154285073 18:13047250-13047272 TATGAGAACCAGTTGGATGCTGG + Intronic
1156649605 18:39209659-39209681 CATTTGAAGCACTTGGACTTAGG - Intergenic
1157391812 18:47309402-47309424 GATGAGAAGCAGTTGGGTTCTGG + Intergenic
1157988019 18:52462094-52462116 CCTGACAAGCAGTTGAATTCTGG - Intronic
1158150660 18:54365519-54365541 GATAAGAAGGGGTTGGATTCTGG + Intronic
1160382326 18:78469922-78469944 CATTGAAAGCAGTTGTATTCGGG - Intergenic
1160684192 19:425934-425956 CATGAGAATCACTTGAATTCAGG + Intronic
1163336059 19:16672539-16672561 CATGAGAATCACTTGAATTCAGG - Intronic
1163336580 19:16676428-16676450 CATTAGAATAAGTTGTATTAGGG + Intronic
1164737952 19:30555795-30555817 CATTAGAACCTGCTGGCTTCTGG - Intronic
1164814289 19:31182554-31182576 CCTTAGAAGCACTTGGAATGAGG - Intergenic
1164925516 19:32127008-32127030 CACTACAAACATTTGGATTCTGG - Intergenic
1168596701 19:57683263-57683285 TGCGAGAAGCAGTTGGATTCTGG + Intronic
926587526 2:14704689-14704711 CATTAGAAATAGTTGGAATATGG + Intergenic
926771605 2:16382011-16382033 CATGAGAACTAGTTGGATTTTGG + Intergenic
927065334 2:19465256-19465278 CATGAGAAGCAGCTGTTTTCAGG - Intergenic
928985166 2:37173747-37173769 GATGAGAAGAGGTTGGATTCTGG - Intronic
929449524 2:42027504-42027526 GATTGGACGCAGGTGGATTCAGG - Intergenic
929663822 2:43817541-43817563 CATAAGAAGCATTTGTATTAGGG - Intronic
930234312 2:48874278-48874300 CCCTAGAAGCGGTTGGGTTCTGG + Intergenic
930726669 2:54688277-54688299 CCTGAGAAGCAGTGGGATTGGGG - Intergenic
931366640 2:61624939-61624961 CAGAAGAAGCTGTAGGATTCTGG + Intergenic
931692414 2:64846446-64846468 CTTTAGAAGGAGTTGGGCTCTGG + Intergenic
935413042 2:102786150-102786172 CATTTGAAGCACTGGAATTCCGG + Intronic
935880206 2:107557788-107557810 CATGAGAAGCAGTTGAACTGGGG + Intergenic
938154639 2:128923920-128923942 CATTATAAGGAGTTGGATGTTGG + Intergenic
939572765 2:143860618-143860640 CATTACAAGCAATTAGACTCTGG + Intergenic
939574784 2:143883055-143883077 GATGAGAAACAGTGGGATTCTGG - Intergenic
941105740 2:161350750-161350772 AGTTAGAAGCAGTTAGATTTTGG + Intronic
941260345 2:163289390-163289412 CATTAGAAGCTGAAGGTTTCAGG - Intergenic
941268473 2:163394466-163394488 CATGAGAAGCAGATGGCTTGTGG - Intergenic
942631422 2:177954107-177954129 CATAAGAATCTGTAGGATTCAGG - Intronic
943894250 2:193333018-193333040 GATTAGCAGCTGTTGAATTCTGG + Intergenic
1169827152 20:9781787-9781809 AGTGAGAAGCAGTTGGAATCTGG - Intronic
1170793972 20:19530711-19530733 CATCAGAAGTGGTTGCATTCTGG - Intronic
1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG + Intronic
1173260439 20:41430218-41430240 CATTAAAAGCAGTTGAAATGGGG - Intronic
1174115339 20:48223079-48223101 AATGAGAAGCAGTTGGATCCTGG + Intergenic
1174120993 20:48265367-48265389 CATGAGAAGTGGTTGGGTTCTGG + Intergenic
1174493500 20:50921647-50921669 CAGTAGAACCAGTTGTTTTCAGG + Intronic
1175584178 20:60124643-60124665 CAAAACAAGCAGTTTGATTCAGG - Intergenic
1176254310 20:64143023-64143045 CCCTAGAAGCAGTAGGATTTGGG - Intergenic
1177550843 21:22620201-22620223 GGTGAGAAGCAGTAGGATTCTGG + Intergenic
1179467116 21:41583216-41583238 CATTAGATGGAGTTGGAATGAGG + Intergenic
1182953630 22:34400368-34400390 CTTTAGAGGCAGTTTGTTTCAGG + Intergenic
1183056121 22:35307087-35307109 CATGAGAAGCAGGGGGATTCAGG + Intronic
1183058503 22:35321261-35321283 CATGAGAAGCATTCAGATTCAGG + Intronic
1183240718 22:36656443-36656465 GATGAGAAGTGGTTGGATTCGGG - Intronic
951095289 3:18622254-18622276 AATTAGATGCAGGTGGATTGTGG + Intergenic
952855973 3:37771109-37771131 CATGAGAAGCATTTGGACTCCGG + Intronic
955755275 3:62219515-62219537 CATGAGAAGCAGTGAGAATCCGG - Intronic
956138234 3:66119887-66119909 TGATAGAAGCGGTTGGATTCTGG + Intergenic
956153690 3:66271058-66271080 CATTGGAAGCTATTGGATACAGG + Intronic
960236139 3:115284958-115284980 CCTCAGAAGCATTTGTATTCAGG + Intergenic
962587144 3:136853186-136853208 CATGAGAATCACTTGAATTCAGG - Intronic
964386848 3:156156513-156156535 GGTGAGAAGTAGTTGGATTCTGG + Intronic
964449605 3:156799463-156799485 CCAAAGAAGCAGTTGGACTCAGG + Intergenic
964676497 3:159288324-159288346 AATTAGAAGCAGTTGCATGAGGG - Intronic
967354714 3:188555495-188555517 GATAAGAAGTAGTGGGATTCTGG + Intronic
968014522 3:195317441-195317463 TATGAGTAGTAGTTGGATTCTGG - Intronic
968231475 3:197007298-197007320 CTTTAGAATCAGTGGGATGCTGG - Intronic
969609848 4:8220853-8220875 CATCAGAAGCAGCTGGAAGCTGG + Intronic
970849418 4:20583509-20583531 CATTAAAAACAGTTAGGTTCAGG + Intronic
971049505 4:22845157-22845179 CATGAGAATCACTTGGATTTGGG - Intergenic
972444528 4:39130625-39130647 CATTAGAATCACCTGGGTTCTGG - Intergenic
974789171 4:66663762-66663784 TATTAAAAGCAATTGGATTCTGG + Intergenic
975258319 4:72266510-72266532 TAATCGAAGCAGTTTGATTCAGG + Intergenic
976092034 4:81469116-81469138 TATTAGTAGTAGTTGAATTCAGG - Intronic
976978514 4:91194060-91194082 CAGGAGAATCACTTGGATTCGGG - Intronic
977377307 4:96222227-96222249 TATGAAAAGCAGATGGATTCTGG - Intergenic
978532162 4:109726451-109726473 AATGAGAAGTAGTTGGATTTTGG - Intronic
979520254 4:121657779-121657801 CAGGAGAATCAGTTGAATTCAGG + Intergenic
980746497 4:137023408-137023430 TATTAGAAACAGCTGCATTCAGG + Intergenic
981522088 4:145673343-145673365 TATGAGGAGCAGATGGATTCAGG + Intergenic
989475871 5:41871775-41871797 CATTTTAAGAAGTTGGATTGGGG + Intergenic
991345713 5:65665064-65665086 AAAAAGAAGCAGTTGGACTCGGG + Intronic
991381628 5:66034134-66034156 TATGAGAAGCAGTTGGATAATGG + Intronic
991537482 5:67687122-67687144 TATGAGATGCAGTTGGCTTCTGG + Intergenic
992730020 5:79654669-79654691 CATGAGAATCACTTGAATTCGGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
995009144 5:107238618-107238640 GATGAGAAGCAGTTGGATTAGGG + Intergenic
996411275 5:123161973-123161995 GGTGAGAAGTAGTTGGATTCTGG + Intronic
998188647 5:140002865-140002887 GATGAGAACTAGTTGGATTCTGG + Intronic
998265691 5:140665906-140665928 CAGAAGAATCACTTGGATTCGGG + Intronic
999076969 5:148805810-148805832 CATTAGCAGCAGTTGCAAACTGG - Intergenic
999444785 5:151630707-151630729 CATGAGAATCACTTGGATCCGGG - Intergenic
1000882889 5:166717562-166717584 AATAAGAAGTAGTTGGGTTCAGG + Intergenic
1001319971 5:170672450-170672472 CTTTGGAAGCGTTTGGATTCTGG - Intronic
1001343025 5:170864490-170864512 CATTCAAAGCAGTTGCATTCTGG + Intronic
1002756745 6:168156-168178 CATTAGAAATACTTGTATTCAGG + Intergenic
1004311187 6:14546668-14546690 TATTAGAAGTACTTGGGTTCTGG - Intergenic
1004760733 6:18663203-18663225 AATTAGGAGCAGTTTCATTCTGG + Intergenic
1008560882 6:52723593-52723615 CATGAGAATCACTTGGACTCAGG - Intergenic
1014635212 6:123837490-123837512 AGTGAGAAGTAGTTGGATTCTGG - Intronic
1016931287 6:149412891-149412913 CATGAGAATCACTTGAATTCAGG + Intergenic
1018540546 6:164874950-164874972 CATTGGAAGTAATTGTATTCTGG + Intergenic
1018681661 6:166270351-166270373 GATGAGAAGCAGGAGGATTCTGG + Intergenic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1022819388 7:33944256-33944278 CATGAGAATCACTTGGATGCAGG - Intronic
1022956695 7:35387376-35387398 CATGAGAAGAAGTTAGATTCAGG - Intergenic
1026430466 7:70342017-70342039 CATTAGAATCAAATGCATTCGGG + Intronic
1029671238 7:102032574-102032596 CATGAGAATCAGTTGAACTCGGG + Intronic
1031313096 7:120223870-120223892 AATTGGAAGCAGTTGTGTTCTGG + Intergenic
1033870252 7:145745561-145745583 CAGGAGAATCAGTTGAATTCAGG + Intergenic
1037019112 8:13946172-13946194 CATCTGATGCACTTGGATTCAGG + Intergenic
1037218739 8:16490161-16490183 AGTGAGAAGCAGTTGGATTCTGG - Intronic
1038774713 8:30518516-30518538 CATTAGAAGCACTTGAACCCAGG - Intronic
1038789354 8:30654803-30654825 AATTAGAAGAAGGTGGATTTAGG + Intronic
1042841654 8:73130302-73130324 CATTACAAGCAATTGGAATAAGG + Intergenic
1044661626 8:94597008-94597030 CATTAGAAGAAGTTGGGTGAAGG + Intergenic
1045229656 8:100290952-100290974 CCTTAGAGGCAGTTGGCTTCTGG - Intronic
1045405905 8:101866709-101866731 AATGAGAAGAGGTTGGATTCTGG - Intronic
1046607162 8:116384125-116384147 CAGTGGAAGCTGTTGGTTTCAGG - Intergenic
1049814989 8:144594790-144594812 CATGAGAATCACTTGGATCCGGG + Intronic
1050208065 9:3219334-3219356 CTTTAGAAGAATTTTGATTCTGG - Exonic
1052757875 9:32559282-32559304 GATGAGAACCAGTTGGATTCAGG - Intronic
1053904867 9:42831360-42831382 CATTAGAAGCAGTTATCCTCGGG - Intergenic
1054949867 9:70837911-70837933 CATTAGAGACAGTTGGATCTTGG + Intronic
1055437068 9:76302343-76302365 CATTAGAAAAAGTTGGAGACAGG + Intronic
1056429441 9:86512669-86512691 GATTATAGGCAGTTGGTTTCAGG - Intergenic
1058727207 9:107815695-107815717 CTTTAGGTGCAGCTGGATTCAGG + Intergenic
1059793059 9:117661690-117661712 CCTTATAAGCAGTTGGATAGAGG + Intergenic
1060204662 9:121675434-121675456 CATTAGAAGCAGTCGGGCTTAGG + Intronic
1060295501 9:122340469-122340491 CATTATTAGCAGTGTGATTCAGG - Intergenic
1062569387 9:137178100-137178122 CATTAGAAGCTGCCGGATCCTGG - Intronic
1185825077 X:3242096-3242118 CATTAGTAACAATGGGATTCAGG - Intergenic
1189558541 X:42169469-42169491 AGTGAGAAGCAGTTGGATCCTGG + Intergenic
1190145860 X:47891154-47891176 CACTAGAAGCAGTTTGTTTTTGG - Intronic
1191996165 X:67097392-67097414 CCCTAGAAGCAGTGGAATTCTGG + Intergenic
1193480171 X:82017916-82017938 TATCAGAAGCAGTTTGATTTCGG + Intergenic
1196841392 X:119862534-119862556 CATGAAAAGGAGTTGGATTTGGG - Intergenic
1197859238 X:130951483-130951505 AGAGAGAAGCAGTTGGATTCTGG - Intergenic
1198525763 X:137498841-137498863 CATTAGAATCACTTGAACTCAGG + Intergenic
1200157188 X:153983284-153983306 CCTTAGAGGCGGCTGGATTCAGG + Intergenic
1200317165 X:155146400-155146422 CATCAAAACCAGTTGGGTTCTGG - Intronic
1201254236 Y:12091349-12091371 CATTAGTAACAATGGGATTCAGG + Intergenic