ID: 1172957379

View in Genome Browser
Species Human (GRCh38)
Location 20:38770804-38770826
Sequence CAACATGCACAAATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172957379_1172957383 -8 Left 1172957379 20:38770804-38770826 CCCACCTCCATTTGTGCATGTTG 0: 1
1: 0
2: 0
3: 28
4: 168
Right 1172957383 20:38770819-38770841 GCATGTTGATTCCACTGTTATGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172957379 Original CRISPR CAACATGCACAAATGGAGGT GGG (reversed) Intronic
902064940 1:13677162-13677184 CCACATGCAAAAAGTGAGGTTGG - Intergenic
903867575 1:26410545-26410567 CCACACGCACAACTGGAGATGGG - Intergenic
906049355 1:42857716-42857738 AGACATGGAGAAATGGAGGTGGG - Intergenic
906459137 1:46023942-46023964 CACCATGCACAAGTGGCGCTTGG - Exonic
906708961 1:47915197-47915219 CATCATGCACAAAAGCAGGGAGG + Intronic
907044101 1:51289175-51289197 CAACCTGGAGAAAGGGAGGTCGG - Intronic
907111799 1:51933502-51933524 CAACATGTAAATTTGGAGGTGGG - Intronic
909144908 1:71917850-71917872 CAAAAAGCACAAATTGAGTTAGG + Intronic
909268905 1:73598423-73598445 TAACTTGCACCAGTGGAGGTTGG - Intergenic
909300816 1:74011014-74011036 CACCAGGCTCAAATGGAAGTAGG + Intergenic
911228721 1:95336813-95336835 CAACATTTACAATTGGAGGATGG - Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
916167193 1:161974504-161974526 GAACAAGAACAAAGGGAGGTTGG - Intergenic
916654146 1:166858661-166858683 CAACAGGCAAAAATGGAGAGTGG + Intronic
917791900 1:178504370-178504392 CAACAGGGACAAAGGGAGGAAGG + Intergenic
918929457 1:190835193-190835215 CAACATGCAAATTTGGAGATGGG - Intergenic
921031862 1:211341101-211341123 CTACATTCCCAAATGGGGGTGGG - Intronic
921839472 1:219813013-219813035 CAAAAGGTCCAAATGGAGGTAGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1063063600 10:2585742-2585764 CAACATGCACATTTAGGGGTAGG + Intergenic
1066704584 10:38164344-38164366 CTACATTCTCACATGGAGGTAGG - Intergenic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1070745489 10:78931304-78931326 CAAAACACACAAAGGGAGGTGGG + Intergenic
1072225464 10:93364625-93364647 CCAAATGCCCAAATGGAGTTTGG - Intronic
1075511961 10:123079749-123079771 CAAACTGTACAAATGGTGGTTGG - Intergenic
1076790997 10:132776712-132776734 CAACATGCCCATTTGGGGGTGGG + Intronic
1080099469 11:28442850-28442872 AAACATTTAGAAATGGAGGTTGG - Intergenic
1085148160 11:74222782-74222804 CAAAATGCCCAAATCGAGCTGGG - Intronic
1085321047 11:75574242-75574264 CATCATGCACATATCGAGGAAGG + Intergenic
1086784427 11:90949191-90949213 CAAAATGAACATTTGGAGGTAGG + Intergenic
1090093098 11:123716836-123716858 CAACATGCACAGAGGGCTGTGGG - Intergenic
1090760534 11:129833338-129833360 CAACATATACACTTGGAGGTGGG - Intronic
1093122594 12:15290864-15290886 CAAAATACAAAAATGGAGGCTGG + Intronic
1093675815 12:21939365-21939387 CAACATGGACAAAAAGAGGGAGG + Intronic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1097969324 12:65615637-65615659 CAACATGAATAAAAGGAGGTGGG - Intergenic
1098139495 12:67437297-67437319 CCACATGCAGAAATGCATGTTGG + Intergenic
1098613606 12:72493924-72493946 CTACATGTAAAAATGGAAGTAGG - Intronic
1099765739 12:86980681-86980703 CCACATACACAAATATAGGTGGG + Intergenic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1103919325 12:124391201-124391223 CAACATCCCCAGATGCAGGTGGG - Intronic
1104745755 12:131209446-131209468 CAACAACCACAAATGGAGAGTGG + Intergenic
1104788546 12:131467334-131467356 CAACACCCACAAATGGAGAGTGG - Intergenic
1106215362 13:27692993-27693015 CAACATGCGTAAAAGGAGGGAGG + Intergenic
1108521093 13:51247516-51247538 CCACATGCACACCTGGGGGTGGG + Intronic
1110277301 13:73654412-73654434 AAACATGAAAAAATTGAGGTTGG + Intergenic
1114029257 14:18561536-18561558 CAAGATGGACAAATGTAGGTTGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1116997269 14:51336790-51336812 GAAGATGCACAAATTGAAGTTGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1125540832 15:40469080-40469102 CAAAATGCAGAAGTGGAGGCGGG - Intergenic
1128565214 15:68696634-68696656 CAACTTTCACCAGTGGAGGTAGG + Intronic
1128597025 15:68962097-68962119 CAACTTCAACAAATGGAGGAAGG - Intronic
1129224030 15:74155682-74155704 CAAAGGGCACAAATGGGGGTGGG - Intergenic
1132752105 16:1462858-1462880 CCACATGCAAAAATGAAGCTGGG + Intronic
1133851283 16:9506097-9506119 CGACAGGCAGGAATGGAGGTGGG + Intergenic
1134033863 16:11014815-11014837 CAACAGGGACAATTGGAGTTGGG + Intronic
1134295709 16:12943758-12943780 CAATATCTACAAATGGAGGCAGG - Intronic
1135525082 16:23208096-23208118 AAACAAGCAAAAATGGGGGTGGG - Intronic
1136293624 16:29290031-29290053 CCACATGCACTCATGGAGCTCGG + Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1140746454 16:77984784-77984806 CAGCATTGACAAGTGGAGGTAGG - Intergenic
1141429256 16:83962607-83962629 TAACATGTACACATGGTGGTCGG + Intronic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1147626708 17:41905032-41905054 CAACATCCAAAAATCCAGGTTGG + Intronic
1148635312 17:49144609-49144631 CACCATGCCCAACTGGAGCTAGG - Intronic
1148665647 17:49372584-49372606 CAACATGCTCCAGTGGAGGACGG + Intronic
1148703200 17:49604480-49604502 CCTCAGGCACAAAGGGAGGTAGG + Intronic
1148866655 17:50632266-50632288 CCACTTGCAGAAAGGGAGGTAGG + Intergenic
1151986904 17:77549397-77549419 GAACAGACACACATGGAGGTTGG - Intergenic
1152507163 17:80757471-80757493 AAACAAGCAGAAATAGAGGTAGG - Intronic
1154130466 18:11732708-11732730 CAACATTTACAAATGGAGGAGGG + Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156699301 18:39806181-39806203 CAACATGAGCAACTGGAGGGAGG - Intergenic
1158039153 18:53071531-53071553 ACACATGCACAAATAGAGGATGG + Intronic
1158593158 18:58794305-58794327 CTTCCTGCACAAATAGAGGTGGG + Intergenic
1158928544 18:62297017-62297039 CACCATACCCTAATGGAGGTAGG - Intronic
1159280069 18:66273883-66273905 GAACATGCACCCATGGTGGTCGG - Intergenic
1161102528 19:2428321-2428343 CAACCTGCAAAAACGGAGCTGGG - Exonic
1161317725 19:3626015-3626037 CAACATTTGCTAATGGAGGTGGG - Intronic
1161422204 19:4182206-4182228 CGACAGGCGCAAAGGGAGGTGGG - Intronic
1162274387 19:9641261-9641283 ACACATGGAGAAATGGAGGTGGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
925043450 2:752098-752120 GAACGTGCAAAAATGGAGGTTGG + Intergenic
930648300 2:53936228-53936250 CAAAAAGAACAAATGGAGGAGGG - Intronic
930843444 2:55874292-55874314 CTACATGCAACATTGGAGGTAGG + Intronic
930872305 2:56182670-56182692 AAACATTCACCAATGGAAGTTGG + Intergenic
933217009 2:79642668-79642690 CACCATGTCCAAATGGAGGTGGG - Intronic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
934605041 2:95688272-95688294 GAACATGGAGAAATGGAGGCTGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939228169 2:139389709-139389731 CAAAATGTACAAATAGATGTTGG - Intergenic
939275860 2:139994892-139994914 CAACAGGCAGAGATGAAGGTCGG - Intergenic
947445385 2:230158819-230158841 CCACATGCACACTTGGAGGATGG + Intergenic
948151812 2:235750556-235750578 CCACATGCACAAGTGCAGGCAGG - Intronic
1170875800 20:20248875-20248897 CAAAAAGCAAAAATGGAGGACGG - Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1172974246 20:38894443-38894465 CAACGTGCACACATGTACGTGGG + Intronic
1178677338 21:34642384-34642406 CAACATGACCAAAGGCAGGTGGG - Intergenic
1178717303 21:34977607-34977629 CAACATATACACATGGAAGTGGG + Intronic
1178994592 21:37387069-37387091 GCACATGCCTAAATGGAGGTGGG + Intronic
1179118606 21:38520608-38520630 CAACATGCACAAAGGAAAGCTGG + Intronic
1179955078 21:44734047-44734069 CAACATGCAAAAATAGATCTTGG + Intergenic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180453373 22:15488599-15488621 CAAGATGGACAAATGTAGGTTGG - Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181901718 22:26161493-26161515 CAGCATGAACAAATGTGGGTTGG + Intergenic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1183349756 22:37328468-37328490 CCACAGGCACAAATGTGGGTAGG - Intergenic
1184961313 22:47930861-47930883 AAAGATGCAGAAATGGGGGTAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949409223 3:3745635-3745657 CAACATGCACAAAGAGAAGATGG - Intronic
950712922 3:14826335-14826357 CAACATGCACTAATGGATGAGGG - Intronic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
951362098 3:21737572-21737594 CAAAATGCACCTATGGTGGTTGG + Intronic
951853344 3:27167895-27167917 CAACATGAGCAAATGGAACTAGG - Intronic
953330632 3:42050247-42050269 CACCAGGCACAAATGAAAGTAGG - Intronic
953460002 3:43074366-43074388 CAAGAACCACAAATGGAGCTGGG - Intergenic
955971741 3:64444478-64444500 CGCCTTGCATAAATGGAGGTAGG - Intronic
957977019 3:87459646-87459668 GAACATGCAGAAATGGAAGTTGG + Intergenic
958691055 3:97466782-97466804 CAATATGCACAAGAGGAAGTTGG - Intronic
958755318 3:98244812-98244834 AGACATGGAGAAATGGAGGTGGG - Intergenic
959974652 3:112445078-112445100 GAACATGCAGAACTGGAGTTAGG - Intergenic
962930562 3:140032038-140032060 GAACAAGCACAAGTAGAGGTGGG + Intronic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
964955686 3:162353329-162353351 CACCATGCCATAATGGAGGTGGG + Intergenic
967264239 3:187676091-187676113 CGGCATGTGCAAATGGAGGTGGG - Intergenic
968801791 4:2747674-2747696 CAGCATGCACAAAGGAATGTGGG - Exonic
970359590 4:15295545-15295567 CAACATGCACCAATTCAGTTGGG + Intergenic
971764108 4:30806816-30806838 CAACATGGGCAAATTAAGGTTGG - Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
978382272 4:108141858-108141880 GAACATGCAAAGATGGGGGTGGG + Intronic
979866919 4:125767652-125767674 CAACAAGCACAAAATGAGCTTGG + Intergenic
980960749 4:139471910-139471932 CAACATGCAAAAAATGAGGCTGG - Intronic
982750036 4:159149941-159149963 AAACAGGCACAGGTGGAGGTTGG + Intronic
987063975 5:14269851-14269873 AAACAAACACAAATGGGGGTGGG + Intronic
987168936 5:15232575-15232597 CAAAATCCACAAATGCAAGTGGG - Intergenic
988089339 5:26516078-26516100 AAACATACACAAATGGTGGAAGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990907759 5:60822025-60822047 CAACATTCCCAAAAGGAGGAAGG - Intronic
992719391 5:79545309-79545331 CGAAATGGAGAAATGGAGGTGGG - Intergenic
995401048 5:111742021-111742043 TAACATGTACAAATAGAGGTTGG + Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999647573 5:153734431-153734453 CAAGAGTCTCAAATGGAGGTGGG + Intronic
1001015038 5:168133069-168133091 CCACATGGAGAAATTGAGGTCGG - Intronic
1004318893 6:14616728-14616750 CAGCATGAACGAATGGAGGTGGG - Intergenic
1004885612 6:20049120-20049142 CAGCCTGCACACATGAAGGTAGG - Intergenic
1006487077 6:34351921-34351943 TAAGATGTATAAATGGAGGTGGG + Intronic
1008198029 6:48549812-48549834 CAACATGTACAAATTTATGTTGG - Intergenic
1010333053 6:74646815-74646837 ACACATGCACCAATGGAGGTGGG - Intergenic
1012520150 6:100111542-100111564 CAACATCCACAAGAGGTGGTGGG - Intergenic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1014986509 6:128017650-128017672 CAACAGGCAGAAAGAGAGGTTGG - Intronic
1017945167 6:159090705-159090727 CAACCTGCCAAATTGGAGGTGGG - Intergenic
1022903244 7:34831073-34831095 CGACATGGACAAAGTGAGGTTGG - Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027914119 7:84292619-84292641 GAAAATGCACAAATTGGGGTTGG + Intronic
1027943497 7:84715639-84715661 GACCATACACAAATGGAAGTTGG + Intergenic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031112713 7:117631132-117631154 CAAAATCCAAAATTGGAGGTTGG - Intronic
1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG + Intronic
1032601454 7:133300503-133300525 CTTCATGTACAAATGGTGGTCGG - Intronic
1035013667 7:155743944-155743966 CAAACTGCAAAAATGAAGGTGGG - Intronic
1037484054 8:19330956-19330978 CACCATGCCCAAATGGGGCTGGG - Intronic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1041706190 8:60848706-60848728 CAAGATGCAAAAAAGGAGATGGG - Intronic
1043587211 8:81783404-81783426 CAACAGGCACGAATGCAGGGAGG - Intergenic
1045417330 8:101980235-101980257 CAACAAGGAAAAGTGGAGGTGGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1047053886 8:121143172-121143194 CAACAAGAACAAGTGGAGATTGG + Intergenic
1058852621 9:109027391-109027413 CAACAGGCAGAAATGAGGGTGGG + Intronic
1187241711 X:17519956-17519978 CCATAAGCACAAATGGGGGTGGG - Intronic
1188368836 X:29343900-29343922 CACCACACACAAATGTAGGTAGG + Intronic
1188670189 X:32872695-32872717 CAAGATGCACAAAGGGAAGTAGG + Intronic
1188790931 X:34407569-34407591 CAACATTAAAATATGGAGGTGGG + Intergenic
1189418127 X:40832584-40832606 CAGCATGCACAAAGGAACGTGGG - Intergenic
1192216654 X:69164118-69164140 CAGCAGGCACAAATGGAAGCGGG + Intronic
1192587276 X:72329046-72329068 CAACATGGAAAAATGGGGATGGG - Intergenic
1194890808 X:99376158-99376180 CACCATGCATAAATGAAGGCAGG - Intergenic
1195117048 X:101709607-101709629 CAACATGCACAAATCAGGCTGGG + Intergenic
1196686489 X:118514704-118514726 CAGCATGCACAAAGGTATGTAGG - Intronic
1198330475 X:135618095-135618117 CAACATGCTCAAATTCTGGTGGG - Intergenic
1198336452 X:135670904-135670926 CAACATGCTCAAATTCTGGTGGG + Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic
1201912830 Y:19150871-19150893 CAACATGCAAAAGTGGAAGAAGG - Intergenic