ID: 1172957447

View in Genome Browser
Species Human (GRCh38)
Location 20:38771173-38771195
Sequence CACTCTGAGTAGAGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172957447_1172957461 16 Left 1172957447 20:38771173-38771195 CCTGTTTCCCTCTACTCAGAGTG 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1172957461 20:38771212-38771234 AGGCCTTTTCCCCAGGTCACGGG 0: 1
1: 0
2: 2
3: 18
4: 184
1172957447_1172957456 -8 Left 1172957447 20:38771173-38771195 CCTGTTTCCCTCTACTCAGAGTG 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1172957456 20:38771188-38771210 TCAGAGTGGGGAGCGGGGCCAGG 0: 1
1: 0
2: 1
3: 42
4: 544
1172957447_1172957457 -4 Left 1172957447 20:38771173-38771195 CCTGTTTCCCTCTACTCAGAGTG 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1172957457 20:38771192-38771214 AGTGGGGAGCGGGGCCAGGAAGG 0: 1
1: 0
2: 10
3: 75
4: 776
1172957447_1172957458 9 Left 1172957447 20:38771173-38771195 CCTGTTTCCCTCTACTCAGAGTG 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1172957458 20:38771205-38771227 GCCAGGAAGGCCTTTTCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 254
1172957447_1172957460 15 Left 1172957447 20:38771173-38771195 CCTGTTTCCCTCTACTCAGAGTG 0: 1
1: 0
2: 1
3: 8
4: 177
Right 1172957460 20:38771211-38771233 AAGGCCTTTTCCCCAGGTCACGG 0: 1
1: 0
2: 2
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172957447 Original CRISPR CACTCTGAGTAGAGGGAAAC AGG (reversed) Intronic
900347207 1:2215462-2215484 CCCTCTGAGTAGCGGGAAGGTGG + Intergenic
901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG + Intergenic
903797116 1:25937760-25937782 CCCTCTGAGTAGATGGGACCTGG + Intergenic
904326715 1:29731297-29731319 CACACTGAGAAGAGGGCAGCAGG - Intergenic
904357036 1:29946941-29946963 CACTCAGAGTAGAGGTAAGAGGG + Intergenic
908520377 1:64935638-64935660 CAGTCTGAGTAGGAGGAAAGAGG - Intronic
909119570 1:71584433-71584455 CACTCTGACTAAAGAGAAATAGG + Intronic
909933647 1:81527243-81527265 CACTTTGTGATGAGGGAAACTGG - Intronic
910614166 1:89178935-89178957 CACCCAGAGAAGAGGTAAACAGG + Intergenic
911481823 1:98452456-98452478 CACTCTAAGTAGAGCTGAACAGG - Intergenic
915147280 1:153802586-153802608 GACTCAGAGTGGAGGGAAGCTGG + Intergenic
916180346 1:162078108-162078130 CACTCACAGTAGAGGGCAAAGGG - Intronic
917226334 1:172788044-172788066 CACTCTGAAGAGAAGGACACAGG - Intergenic
917272169 1:173289077-173289099 CTCTGTGAGTTGAGGGGAACAGG + Intergenic
919255768 1:195122486-195122508 CACTTTGGGGAGAGGGAAATAGG - Intergenic
921387115 1:214580693-214580715 TACTCTGAATGGAGGCAAACAGG - Intergenic
922905396 1:229170092-229170114 CATTCTGAGCAGAGTCAAACAGG - Intergenic
1063594925 10:7425804-7425826 CATTGTAAGTAGAGAGAAACAGG + Intergenic
1064475980 10:15689846-15689868 CACTCTGAGTAGCTGGCAGCAGG - Intronic
1065414338 10:25468095-25468117 CATGCTGAGAAGAGGGAAAGAGG - Intronic
1068956706 10:62824945-62824967 CACTGTGAGGAGAGGAAAAGAGG - Intronic
1074679288 10:115887696-115887718 CTCACTGAGAAGAGGAAAACTGG - Intronic
1074743201 10:116504985-116505007 CACTTTGAGTAGGCGGAAAAAGG + Intergenic
1076252657 10:128996246-128996268 CACTCTGCAGAGAAGGAAACTGG + Intergenic
1076472136 10:130726546-130726568 CACTCTGAAAAGAGGGAGACAGG + Intergenic
1076772830 10:132676405-132676427 CACCCGGAGTGGAGGGAGACAGG - Intronic
1078024209 11:7679423-7679445 CCCCATGTGTAGAGGGAAACAGG + Intergenic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1079493502 11:21015393-21015415 CACTATGAGCACAGGGAAAAGGG - Intronic
1080254944 11:30280256-30280278 CAGTCTGAGTAGAAGAAAAAGGG - Intergenic
1083047922 11:59753539-59753561 CCCTCTGAGCAGAGGCAGACAGG + Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1091463793 12:666118-666140 CTGGCTGAATAGAGGGAAACAGG + Intergenic
1092203789 12:6603446-6603468 CCCACTGAGGAGAGGGAAAATGG + Intronic
1092881681 12:12891943-12891965 AACTTTGAGTAGATGGAATCCGG + Intronic
1094263749 12:28530580-28530602 CACTCTGAGTATAGGAGAAATGG - Intronic
1095618728 12:44223705-44223727 CAATCTGAATAGCAGGAAACAGG - Intronic
1095874292 12:47063717-47063739 CTCTCTGAAGAGAGGGACACAGG - Intergenic
1095886932 12:47198377-47198399 AACTAGGAGTAGAGGGGAACTGG + Intronic
1096111362 12:49031147-49031169 TACTCTGAGTAGAGTGGAGCAGG - Intronic
1097473692 12:60027254-60027276 CACTTTGAATTGAAGGAAACTGG + Intergenic
1100436126 12:94573132-94573154 TACTCTGAGAAGAAGGACACTGG - Intronic
1100656585 12:96652752-96652774 CACTCTGAATATAAAGAAACAGG + Intronic
1102726873 12:115073478-115073500 CAGGCTGAGTAAGGGGAAACAGG + Intergenic
1103174047 12:118846327-118846349 CACTCTTAGTGGAGGGACATTGG - Intergenic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104360918 12:128132472-128132494 CATTCTGAATATGGGGAAACAGG + Intergenic
1106196668 13:27499823-27499845 CTCTCTGAGTAGACAGAAAGGGG + Intergenic
1107057625 13:36124338-36124360 CCCTCTGAATAGAAGGAAAAAGG + Intronic
1110116999 13:71830853-71830875 CACTTAGAGTAGAGAGAAACAGG - Intronic
1110762932 13:79250741-79250763 CATTCTCAGTAAAGGGAAGCAGG - Intergenic
1115729573 14:36254174-36254196 CACGCTCTGTAGAGGGAGACAGG + Intergenic
1116860753 14:49993827-49993849 CATTTTAAGTAGAGGTAAACTGG + Intronic
1117623237 14:57609343-57609365 TACCCTGAGTTCAGGGAAACTGG + Intronic
1118750646 14:68805835-68805857 AAGTGTGAGTGGAGGGAAACTGG + Intergenic
1124011601 15:25843628-25843650 AACTCTGAGTAGATGGAGTCTGG - Intronic
1125085097 15:35720719-35720741 TACTCTGAGTAGGGGAACACCGG + Intergenic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1130086236 15:80780122-80780144 CACTGGGAGGCGAGGGAAACTGG - Intronic
1130361950 15:83197432-83197454 CAATCTGAGTAGAGAGAACCTGG - Intronic
1131380682 15:91961449-91961471 TACTCTGAGGAAAGGAAAACAGG + Intronic
1133330721 16:4971702-4971724 CACTCTGAGACTAGGGAGACCGG + Intronic
1133576239 16:7093583-7093605 CTCGTTGATTAGAGGGAAACTGG + Intronic
1135027278 16:19008157-19008179 CACTCTGAGTGGAGACAGACAGG - Intronic
1135603036 16:23799581-23799603 CAATTTTAGTAGAGAGAAACTGG - Intergenic
1138935542 16:61716992-61717014 CATACCGAGTAGAGGGCAACTGG + Intronic
1140858145 16:78996027-78996049 CACTGAAAGAAGAGGGAAACTGG + Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1144232585 17:13222917-13222939 AACACTGAGAAGAGGGAATCTGG - Intergenic
1144640446 17:16933855-16933877 CACTATGAATAGAGGCAAAGAGG + Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1147646581 17:42037987-42038009 CACTCTGTGAAGAGAGACACAGG - Intronic
1151036863 17:70810676-70810698 CACTCCCAGAACAGGGAAACTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155160360 18:23190384-23190406 CACTGTGAGCCGAAGGAAACCGG + Intronic
1155457922 18:26040842-26040864 CAGTCTTAGTAGAGACAAACTGG + Intronic
1156702599 18:39842609-39842631 TACTCTCAGAAGGGGGAAACAGG - Intergenic
1160474158 18:79167545-79167567 CCCTCAGAGTAGAGGGGACCCGG + Intronic
1161601010 19:5182781-5182803 CGTTCTAAGTACAGGGAAACTGG - Intronic
1162616920 19:11809302-11809324 CATTATGAGAAGAGGGGAACTGG + Intronic
1163570002 19:18075719-18075741 CACTCTGAGTACAGGAACAGGGG - Intronic
1165640451 19:37380826-37380848 CGCTCTAGGAAGAGGGAAACTGG - Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
933220382 2:79680810-79680832 AACTCTGAAAAGAGGTAAACTGG + Intronic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
935213462 2:100957589-100957611 CACTCTTAGTGGAAAGAAACTGG + Intronic
938440273 2:131324153-131324175 CTCTCTGACAATAGGGAAACTGG - Intronic
939619077 2:144395735-144395757 CACTATGAGTAGAGAGATAGTGG - Intronic
940908170 2:159187094-159187116 CACCCAGGGCAGAGGGAAACAGG - Intronic
941064534 2:160886320-160886342 CATTCACAGTAGAGGAAAACAGG + Intergenic
942074842 2:172348020-172348042 CTCTCTGAGTAGAGGAAACTGGG - Intergenic
943456639 2:188116178-188116200 TACTCAGGGTAGAAGGAAACAGG - Intergenic
946927275 2:224638239-224638261 TACTGTGAGTAGGAGGAAACAGG + Intergenic
1169168703 20:3446287-3446309 CACTCAAAGTAGAGAGAAAATGG - Intergenic
1169735102 20:8829327-8829349 CACACTGAGGAGATGGGAACTGG - Intronic
1171502469 20:25604260-25604282 CACTCTGAGTAGATGTGAAAGGG + Intergenic
1172509387 20:35489790-35489812 AACTCTGAGTAGAGGAGAGCAGG + Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173054350 20:39596978-39597000 CCCTCAGTGTAGAGGGAACCTGG + Intergenic
1174457722 20:50661588-50661610 CATTCTGAGGAGAGGCAAAGAGG + Intronic
1175729955 20:61347584-61347606 CGCTCACACTAGAGGGAAACTGG - Intronic
1175763337 20:61576007-61576029 GACTCTGAGTAGGAGGAAAAGGG + Intronic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
949491401 3:4592883-4592905 GACTCTGAGTGGTGGGAGACTGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950854232 3:16090492-16090514 GAATCTGAGAGGAGGGAAACTGG + Intergenic
952305407 3:32141740-32141762 CCCTCTGGGAAGAGGGAAATGGG - Intronic
952519786 3:34145207-34145229 CACTCTGAGAAGAGGGACTTGGG + Intergenic
955870227 3:63430902-63430924 CACTCTGTGAAGAGGAAAAGAGG - Intronic
958674316 3:97247579-97247601 CATTCTGAGTAGAAGGAACCAGG + Intronic
960471770 3:118075145-118075167 CACCCTGAAGGGAGGGAAACAGG - Intergenic
963396694 3:144743553-144743575 CACTCTGAGTAGAAAGGAAGAGG + Intergenic
963956566 3:151260932-151260954 CAGTCTGGGGAGATGGAAACTGG - Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
964950209 3:162282064-162282086 CACACTGAATAGACAGAAACTGG - Intergenic
966283898 3:178270192-178270214 TACTCTGAAGAGAGGAAAACAGG + Intergenic
975837776 4:78442476-78442498 CACCCTGGGCAGAGGGAAAGTGG + Intronic
977378840 4:96243669-96243691 CAACATGAGTAGAGAGAAACTGG + Intergenic
977770343 4:100850510-100850532 CCATCTGAGTACAGAGAAACTGG + Intronic
977797985 4:101191695-101191717 CACTCTGAGGAGAGTTAAGCAGG - Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
981244271 4:142515632-142515654 AACTCAGAGCAGTGGGAAACAGG + Intronic
983996956 4:174193712-174193734 AGCTCTGAGCTGAGGGAAACAGG + Intergenic
986040654 5:3990976-3990998 CACTCTGAGTTGAGGGAGTTTGG - Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
990173187 5:53078035-53078057 CACTCAGACTAGAATGAAACTGG - Intronic
993448711 5:88046911-88046933 GACTCTGAGCAGGGGGAAAGGGG + Intergenic
993569439 5:89518917-89518939 TACTCTGAATACAGGGAAAAGGG - Intergenic
994530196 5:100958970-100958992 CACCTTCAGTAGAGGAAAACAGG + Intergenic
997614459 5:135236997-135237019 CACTCTGTGTAGAGAGGAAGGGG + Intronic
998008248 5:138671946-138671968 CACTCAGAGAAGAAGGAACCTGG - Intronic
999257134 5:150215991-150216013 CACTAGGAGTAGGGGGATACAGG + Intronic
1001778134 5:174344525-174344547 CACTCTGAGCACAGGAAAAAGGG + Intergenic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1004564050 6:16779238-16779260 CACTCTGAAGAGATGGAAAGAGG - Intergenic
1005257320 6:24016818-24016840 CACTCTAAGTAAAGGGAGAAGGG - Intergenic
1005893775 6:30161161-30161183 CACTCACAGTAGAAGGAAAGTGG + Intergenic
1006140043 6:31923043-31923065 CACTCCAGGTAGAGGGAAGCAGG - Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1011896444 6:92232717-92232739 CACTCTGAGAAGAGAGAACAAGG - Intergenic
1012050138 6:94330984-94331006 CACCTTCAGTAGAGGAAAACAGG + Intergenic
1012402077 6:98848995-98849017 CACTCTGGGTAGAAGGGAACTGG + Intergenic
1013184185 6:107743757-107743779 CTCTCTGAGTCCTGGGAAACAGG - Intronic
1013569788 6:111410554-111410576 AAGTATGAGTAGAGGGGAACTGG + Intronic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1015229751 6:130901005-130901027 TAGTCTGAGTAGGGGCAAACTGG + Exonic
1017696008 6:157017042-157017064 CACACTAAGCAAAGGGAAACAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018584039 6:165335857-165335879 CACTCTGAAGAGAGGGACAGTGG - Intronic
1022290406 7:28997094-28997116 TATTCCAAGTAGAGGGAAACGGG + Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023805595 7:43870575-43870597 CACACTGAGAAGAGGGAAAGAGG + Intronic
1025966943 7:66282247-66282269 CACAGTGATTAGAGGGAAATGGG - Intronic
1032093432 7:128923538-128923560 CCCACTGTTTAGAGGGAAACAGG + Intergenic
1032334948 7:131016710-131016732 CACTCTGAGTGTGGGGATACCGG + Intergenic
1032785233 7:135195081-135195103 CACTCTGAGATGAGAGAAAAGGG + Exonic
1035812029 8:2500581-2500603 CAGTCTGAGGATAGGAAAACAGG - Intergenic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1037656930 8:20892315-20892337 CACACTGTGTAGAAGGAGACAGG - Intergenic
1037798579 8:22017794-22017816 CACTGGGAGGAGAGGAAAACGGG + Intergenic
1045330139 8:101148422-101148444 CACTTCGAGTTGGGGGAAACAGG - Intergenic
1046287720 8:112116507-112116529 GACTCTGAAAAGAGGGAAGCAGG + Intergenic
1048414904 8:134216242-134216264 CACTCTGCATAGAGGCAAAATGG - Intergenic
1048840071 8:138557853-138557875 GAATCTGGGTAGAGGGAAAAAGG + Intergenic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1049446208 8:142632688-142632710 CACTCAGAGAAGAGGGATCCTGG - Intergenic
1049568440 8:143355929-143355951 CACTCTTAGAAGAGGGATAAAGG + Intronic
1049938994 9:526688-526710 TCCTCTGAGGAGAGGGAATCAGG - Intronic
1050020102 9:1274591-1274613 CACTCTGATTAGTGGCAATCAGG + Intergenic
1052475627 9:28956026-28956048 CACTGTAAGTAAATGGAAACAGG + Intergenic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1053892725 9:42710866-42710888 CACTCTGATAGGAGAGAAACGGG - Intergenic
1055173044 9:73284283-73284305 GACACTGTGTGGAGGGAAACTGG + Intergenic
1056975656 9:91250847-91250869 CTCTCTAAGTTGAAGGAAACAGG - Intronic
1057969570 9:99541327-99541349 CCCTCTGGTTAGAGAGAAACTGG + Intergenic
1059256917 9:112939262-112939284 CCCCCTGAGTAGATGGAACCGGG + Intergenic
1060070235 9:120540786-120540808 CACTCTGATCAGAGAGGAACAGG - Intronic
1188122164 X:26320560-26320582 CACTGTCAGTATAGGGAATCTGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1194217583 X:91148930-91148952 CACTGAGAGTGGATGGAAACAGG - Intergenic
1195920460 X:109978297-109978319 CTCTCTGAGGAGAGGGCATCTGG + Intergenic
1199834812 X:151578727-151578749 CACTCAGAGGAGAGGGAGAGGGG - Intronic
1202199634 Y:22332277-22332299 CACTCTGGTAGGAGGGAAACTGG + Intronic