ID: 1172957603

View in Genome Browser
Species Human (GRCh38)
Location 20:38772037-38772059
Sequence CTGATGTCTTTGTTCAACTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172957595_1172957603 30 Left 1172957595 20:38771984-38772006 CCTTCAGAATTCGGTTCACTTGG 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1172957603 20:38772037-38772059 CTGATGTCTTTGTTCAACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172957603 Original CRISPR CTGATGTCTTTGTTCAACTG TGG Exonic
902847362 1:19122513-19122535 CTGATCTCTTTGTGCACCTCTGG - Intronic
904279462 1:29408842-29408864 CTGCTGTTTCTGTTCAGCTGTGG - Intergenic
905086349 1:35381779-35381801 TTGATGTCTTTGTTCAGTTCAGG + Intronic
905111444 1:35597575-35597597 CTGAGCTCTTTGTTAAAATGAGG - Intergenic
906239330 1:44232504-44232526 CTGATGATTTTGTGGAACTGAGG - Intronic
906656296 1:47550703-47550725 CTGGTTTCATTTTTCAACTGTGG - Intergenic
907127585 1:52065047-52065069 CTGATGTCTTTGAAGGACTGTGG + Intronic
908023015 1:59917738-59917760 CTAATGTATCTGTTCAACAGAGG + Intronic
910606810 1:89094805-89094827 GTAATGTCCTTGTTCAACTTTGG - Intergenic
911237861 1:95431188-95431210 CTGATGCATTTGTTCACCTATGG - Intergenic
911557884 1:99367722-99367744 CTGATGTCTTTTTTCCACATAGG - Intergenic
915796408 1:158738843-158738865 CTCAAATCTTTGTTCAATTGTGG + Intergenic
916142628 1:161712541-161712563 CTGAAGTCTATGTTCAATTCTGG + Intronic
918420840 1:184362980-184363002 CTGATGTCATTTGTCAAATGTGG - Intergenic
919374182 1:196771435-196771457 CTGATGTCCCTGTTGAACAGAGG - Intergenic
920815957 1:209332308-209332330 CTGACGTCTTTGTACAAGGGTGG + Intergenic
1063620685 10:7645462-7645484 CTGAAGGGTTTGTTAAACTGCGG - Intronic
1068392241 10:56413655-56413677 CTGATGCCTTAGTTCATTTGGGG + Intergenic
1068833412 10:61523745-61523767 CTGATTTCTTTTTTGATCTGAGG + Intergenic
1069183629 10:65394686-65394708 CTGATGTCTGTGTGTATCTGAGG + Intergenic
1070678383 10:78431540-78431562 CTGATGTTTTTACTCAATTGTGG - Intergenic
1073320181 10:102611364-102611386 CTGAGGCCTTTGCTCTACTGAGG - Intronic
1075345879 10:121681697-121681719 AGGATGACTTTGTTCTACTGTGG + Intergenic
1075423771 10:122326170-122326192 CTAATGTCTTTTTTCAACTGGGG + Intronic
1075433970 10:122417874-122417896 CTTATGTCTGTGTTCATCTCTGG + Intronic
1078086437 11:8235952-8235974 CTGATTTGATTGTTCTACTGTGG + Intronic
1078104258 11:8348726-8348748 TTGATGTGTCTGTTCCACTGTGG + Intergenic
1080683640 11:34497742-34497764 CTGATTTCTATTTTCAAGTGTGG + Intronic
1083784640 11:64936894-64936916 CTGATCTATTTGTCCAACTCTGG + Intergenic
1086074758 11:82838467-82838489 CTGATGACTGTTTTCAACAGTGG - Exonic
1088395030 11:109357790-109357812 TTGATGTCATTTTACAACTGTGG + Intergenic
1089257688 11:117202471-117202493 CTGGTGCCTTTGTCCAGCTGCGG - Exonic
1091022990 11:132117697-132117719 CTGATGTATTTGTTTATTTGGGG + Intronic
1091325408 11:134683294-134683316 CTCATGTCCTTGTTCATCAGTGG + Intergenic
1091544503 12:1492399-1492421 CTGCTGTCTTGGTTCCACCGTGG - Exonic
1092623324 12:10298229-10298251 ATTATTTCTTTATTCAACTGTGG - Intergenic
1094886201 12:34876437-34876459 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094897206 12:35055446-35055468 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094902231 12:35136633-35136655 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094903835 12:35162437-35162459 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094914297 12:35331600-35331622 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094918430 12:35398513-35398535 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094957660 12:36034192-36034214 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094959926 12:36070883-36070905 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094976839 12:36343319-36343341 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094981067 12:36411946-36411968 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1094990329 12:36562126-36562148 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1095302711 12:40604581-40604603 CTGATGTCTTTTTACCACTCTGG - Intergenic
1096903708 12:54913156-54913178 CTGACATCTTTGTTCCTCTGTGG - Intergenic
1097448604 12:59708216-59708238 TTGCAGTCTTTCTTCAACTGTGG + Intronic
1097855938 12:64462169-64462191 CTTCTGTCTTTGTTCCTCTGGGG - Intronic
1098588992 12:72187592-72187614 CTGATGTCCTAGCTCAAATGGGG + Intronic
1101488415 12:105189837-105189859 CTGTCGTGTTTGTTCAACTCTGG - Intronic
1104325968 12:127798887-127798909 CTTAAGTCTTTGTTCAAGAGAGG - Intergenic
1106883243 13:34154707-34154729 CAGAAGTCTTTGTGCAACTGAGG - Intergenic
1109038684 13:57301687-57301709 CTTATATCTCTGTTCAATTGTGG + Intergenic
1110356955 13:74577643-74577665 CAGATGTCTTTGTTCATCAGTGG - Intergenic
1110581730 13:77137353-77137375 CTGATTTCTTTGCTCATTTGAGG - Intronic
1110799191 13:79675075-79675097 CTGATGCCTTTGTGCAGCTTTGG - Intergenic
1112107967 13:96262914-96262936 CAGACGTATTTGTTCATCTGTGG + Intronic
1112770726 13:102792089-102792111 CTGATGTCTTAGTTTAAAGGAGG + Intronic
1113001263 13:105640585-105640607 CTCATGTTTTTCTTCAATTGTGG + Intergenic
1113055869 13:106267106-106267128 CTAATGTCTTTGTGCACCTATGG - Intergenic
1116908767 14:50434627-50434649 CTGTTGACTTTATTCAACAGTGG - Intronic
1117567322 14:57007694-57007716 ATGATGTTTTTGTTTAACAGAGG - Intergenic
1119139155 14:72249712-72249734 CTGATGTGTTGATTCAAGTGAGG + Intronic
1119146536 14:72320072-72320094 CTGAGGTTTTTTTTAAACTGTGG - Intronic
1119773032 14:77233285-77233307 CTGATGTCTTTGTTAAAAGTTGG + Intronic
1120052865 14:79888416-79888438 CTGATGTAATTGGTCAAATGAGG + Intergenic
1124914931 15:33960880-33960902 CTAAACTGTTTGTTCAACTGAGG + Intronic
1130316127 15:82798698-82798720 CTGTTTTCTGTGTACAACTGTGG - Intronic
1130393903 15:83485181-83485203 CTGAAATCTGTTTTCAACTGAGG + Intronic
1131009626 15:89005956-89005978 TTCATGTCTTTCTTCAACTTAGG - Intergenic
1132773957 16:1581655-1581677 CTGCTGTGTTGGTTCTACTGGGG + Intronic
1134117123 16:11557339-11557361 CTGTTCTCTTTCTTCACCTGGGG + Intronic
1134598152 16:15512271-15512293 CTGATGCATTTGTCCACCTGTGG - Intronic
1134821872 16:17253497-17253519 CTGATTTTTTTGAACAACTGTGG + Intronic
1135907491 16:26526331-26526353 ATGATGTCTCTCTACAACTGGGG - Intergenic
1135910825 16:26559170-26559192 GTGATGTCCTTGTTCCTCTGGGG + Intergenic
1135991035 16:27218964-27218986 CTGATGTCCTGCTTCAACTCCGG - Exonic
1136470393 16:30475672-30475694 CTGATGCCTTTGACCATCTGTGG - Intronic
1140023795 16:71264826-71264848 CTGATTTCTTTGCAGAACTGTGG + Intergenic
1141247125 16:82318318-82318340 ATCATGTCTTTGTTTATCTGGGG + Intergenic
1141846844 16:86615733-86615755 GTGAGGTCTTTGTTGGACTGGGG + Intergenic
1145245970 17:21269558-21269580 CTGATGGCTCTGTGCCACTGTGG + Intergenic
1145908897 17:28531497-28531519 CTGATGTGTTTGTCCACCTTGGG - Intronic
1146026825 17:29328842-29328864 CAGATATCATTCTTCAACTGTGG + Intergenic
1149034680 17:52120621-52120643 CAGATGTCTTTGTGCAGCTGGGG + Intronic
1155025116 18:21934278-21934300 ATGCGGCCTTTGTTCAACTGAGG - Intergenic
1155308544 18:24502008-24502030 CTGATGTTTGTCTTCAACTTTGG + Intergenic
1155951135 18:31914685-31914707 CTGATGCCTTAGTGCCACTGAGG - Intronic
1156323500 18:36050910-36050932 CTGATTTTTTTTTTTAACTGTGG + Intronic
1156814120 18:41288165-41288187 CTCGAGTCTTTGTTCATCTGAGG - Intergenic
1156854684 18:41768088-41768110 CTGATGTCTTATTTCAAATGTGG + Intergenic
1157557960 18:48625170-48625192 CTGATGTCTTTGCTCACAGGAGG + Intronic
1157746785 18:50142776-50142798 CTGTTGTCATTGTTAGACTGAGG - Intronic
1157943273 18:51952563-51952585 TTGATGTCTTTGGTCAATTTTGG - Intergenic
1158275211 18:55759557-55759579 TTCCTGTCTGTGTTCAACTGGGG - Intergenic
1159880632 18:73855382-73855404 CTCAGGTCCTTCTTCAACTGTGG + Intergenic
1160144922 18:76355998-76356020 CTGTTTTCATTTTTCAACTGAGG - Intergenic
1160356932 18:78236166-78236188 CTCACATCTTTGTTCAACTTGGG - Intergenic
1164344712 19:24898156-24898178 GTGATGTGTGTGTTCAACTCAGG + Intergenic
1167570290 19:50282897-50282919 TTGATGTTTTTGATCAAATGTGG + Intronic
1168294313 19:55371181-55371203 CTGGTGCCTTTCTTCAGCTGCGG - Intergenic
926056698 2:9777884-9777906 CTCATGCCTTTTGTCAACTGTGG + Intergenic
927344546 2:22022584-22022606 CTCATTTCATTGTTCAAATGTGG - Intergenic
928704932 2:33939343-33939365 TTGAAGTATTTGTTCAACTCTGG + Intergenic
928738387 2:34320124-34320146 CTGAAGCATTTGTTCAAATGTGG + Intergenic
929599884 2:43198384-43198406 CTGGTGTCTGTGTTCACCTAAGG - Intergenic
930916686 2:56699830-56699852 CTGATGAGTTCGTTTAACTGTGG + Intergenic
931231818 2:60381582-60381604 CCGATGTCTTTGTTTGTCTGGGG - Intergenic
932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG + Exonic
932557345 2:72836254-72836276 GTGATGTCTTTTTTTAAATGAGG - Intergenic
933890890 2:86768693-86768715 CAGATGACTCTCTTCAACTGAGG + Intronic
935198546 2:100835874-100835896 CTGAGGTCTGTGCTCAGCTGTGG - Intronic
936785776 2:116093029-116093051 TTTATGTCTTTGTTCTACTAAGG + Intergenic
937797886 2:126046894-126046916 ATGATGTCTTTGTGATACTGAGG + Intergenic
939695869 2:145323681-145323703 CTGATGTATGTTTTGAACTGAGG - Intergenic
940102437 2:150056831-150056853 CTCATGTCCTTATTCATCTGTGG - Intergenic
941387934 2:164876072-164876094 CTGTAGTCTTTGTACAACTCAGG + Intergenic
942969934 2:181946033-181946055 CTGTTGTCTGTTTTCAACTTTGG + Intergenic
943947350 2:194084722-194084744 CTGATGTTTTTGTGCAGATGAGG - Intergenic
945354948 2:208829514-208829536 CTGTTGCCTTTGTTCTGCTGGGG + Intronic
948414961 2:237796450-237796472 CAGCTGTTTTTGTTTAACTGTGG - Intronic
1170909035 20:20545191-20545213 ATGTTGAATTTGTTCAACTGTGG - Intronic
1171368291 20:24642257-24642279 CTGATGTCTTTATTAGACTGAGG + Intronic
1172203022 20:33140098-33140120 CTGATGGCTCTGTTCAACCTGGG + Intergenic
1172957603 20:38772037-38772059 CTGATGTCTTTGTTCAACTGTGG + Exonic
1174886590 20:54341923-54341945 CTGAGGTCTGAGTTCAAATGTGG + Intergenic
1174933527 20:54842421-54842443 CTGATGTTTTTTATTAACTGTGG - Intergenic
1177042990 21:16135748-16135770 ATTATGTCTATTTTCAACTGGGG + Intergenic
949941113 3:9155421-9155443 CTCATGTCTTTCTTCAATTATGG + Intronic
951364838 3:21768814-21768836 CTGATTTGTTATTTCAACTGGGG - Intronic
952868120 3:37871646-37871668 TTTATGTCTTTGCTAAACTGGGG + Intronic
953809466 3:46099503-46099525 CTTATATCTTTCTTCAACTCCGG + Intergenic
954661923 3:52230979-52231001 CTGATCTCTGTCTTCACCTGTGG + Exonic
957636853 3:82797751-82797773 CTCGTGTCTTTCTTCAACTCTGG + Intergenic
959526850 3:107386999-107387021 CTGATTTCTGTGTCCAACTCAGG + Intergenic
959902440 3:111675305-111675327 ATGATGTCTTTGTCCCGCTGGGG - Exonic
960663846 3:120091229-120091251 CTTATGTCTGTTTTCAACAGGGG + Intronic
961565314 3:127759497-127759519 GGGATGTCTGTGTTCACCTGCGG + Intronic
962531107 3:136281159-136281181 CTTATGTCTTTCATCAAATGTGG + Intronic
963657589 3:148077074-148077096 TAAATGTCTTTGTTCAAGTGTGG + Intergenic
964026986 3:152086351-152086373 TTGATGTCTTTCTTCAGCTTTGG + Intergenic
965492244 3:169352444-169352466 CTGATGTGGTAGTTTAACTGTGG + Intronic
966592447 3:181697319-181697341 CTGCTGTCTTCTTTCCACTGAGG - Intergenic
968202920 3:196770982-196771004 ATTATGTCTTTTTTTAACTGGGG + Intronic
970705825 4:18801004-18801026 GTGATGTCTTTGCTAAAATGAGG + Intergenic
972140328 4:35951094-35951116 CTGCTGCTTTTGTTCAACTTGGG - Intronic
972865861 4:43231477-43231499 CTGATATCTTCGTTGTACTGAGG + Intergenic
975470934 4:74766778-74766800 ATAATGTCTTTGTTTAACTTTGG - Intronic
976100361 4:81555621-81555643 CTGGAGTTTTTGTTTAACTGAGG + Intronic
977193062 4:94024275-94024297 GTGATGTCTTTGTTTAGCTTTGG - Intergenic
981497078 4:145405935-145405957 CTGATTCTTTTGTTTAACTGAGG - Intergenic
982569168 4:157026800-157026822 ATGATGTCTATCTTCAACTGTGG - Intergenic
983684624 4:170393850-170393872 ATCATGTCCTTTTTCAACTGGGG - Intergenic
986032577 5:3908133-3908155 CTCATGCCTTTGTCAAACTGCGG + Intergenic
986451868 5:7873491-7873513 TTGATTTCTTTGCTCACCTGCGG + Exonic
986512161 5:8519037-8519059 CTGATGTCTGTGTGACACTGTGG + Intergenic
987966288 5:24880189-24880211 CTCATCTCAATGTTCAACTGTGG - Intergenic
988156409 5:27456741-27456763 CTGATTTTTTAGTTCAACTAAGG + Intergenic
989580886 5:43032626-43032648 CTGAGGACTATGTTCCACTGAGG + Intergenic
997345658 5:133190177-133190199 CTCATGTCTTTGGTGAACAGGGG - Intergenic
1000454720 5:161435816-161435838 CTGATATATTTATTCAACTTAGG - Intronic
1000925506 5:167188962-167188984 GTGATGTTTTTGTTCCACTGAGG + Intergenic
1005146290 6:22693885-22693907 CTGGAGGCTATGTTCAACTGGGG - Intergenic
1005861663 6:29907225-29907247 CTACTGTGTCTGTTCAACTGAGG - Intergenic
1006809002 6:36807846-36807868 CTGCGGCCTTTTTTCAACTGAGG - Intronic
1009478436 6:64125011-64125033 CTTTTGTCTTTGTTCAATGGGGG - Intronic
1014683240 6:124460750-124460772 CTTATGTCTTTCTTCAGCTCTGG + Intronic
1015209133 6:130676519-130676541 CTGCTGTCTTACTTCAACTTGGG - Intergenic
1016247624 6:142002783-142002805 CTTATGTCTTTGTTGGATTGTGG - Intergenic
1016733067 6:147447647-147447669 CTGAGGTTCTTGCTCAACTGGGG + Intergenic
1017650366 6:156576037-156576059 CTGATTTTTTTGTTCTTCTGAGG - Intergenic
1018187862 6:161283234-161283256 CTGATGGATGTGTTCAAGTGAGG - Intergenic
1024812586 7:53230229-53230251 CTGATGTCTTTCTGCAAATAAGG - Intergenic
1026011656 7:66640923-66640945 CTGAAGTCTGTGTTCATATGAGG + Exonic
1026615620 7:71900681-71900703 CAGATGTCTGTGGTCACCTGTGG + Intronic
1028823311 7:95238502-95238524 CAGATGTCTTTGGAAAACTGAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031987046 7:128169940-128169962 GTGTTGTCTTTGTTCCACTGAGG + Intergenic
1032102304 7:128991735-128991757 CTGATTTATTTTTCCAACTGAGG - Intronic
1032682114 7:134195534-134195556 CTGATCTTTTTGTTCTATTGAGG + Intronic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1034981068 7:155477017-155477039 CTCATGTCTTTGTACAAATTAGG - Intronic
1038350642 8:26773350-26773372 CTGATGGTTTTGTGCAAATGCGG + Intronic
1038654084 8:29432704-29432726 ATGATGTTTGTATTCAACTGTGG + Intergenic
1039748576 8:40455918-40455940 CCAATGTCTTTGTGCCACTGAGG - Intergenic
1040051530 8:43020124-43020146 CTAATATCTTTCTTCAACTACGG - Exonic
1041773657 8:61499707-61499729 CTCAAGTCTTTGTCCAACTTTGG - Exonic
1044145036 8:88702301-88702323 CTAAACTTTTTGTTCAACTGTGG - Intergenic
1044517526 8:93156602-93156624 CAGATGTTTTTGTGCAAATGAGG + Intronic
1045285407 8:100786530-100786552 CTGATGTCTTTGATCAGTTCTGG - Intergenic
1048480705 8:134789794-134789816 CTGATGTCTTTGGTCAACTCTGG + Intergenic
1048804577 8:138228214-138228236 CTGATGTCTACCTCCAACTGAGG - Intronic
1049035260 8:140070767-140070789 CTGATGGCTTTGATCATGTGTGG - Intronic
1049285213 8:141771160-141771182 CTGATGTGTTTGCACAACTGGGG - Intergenic
1051185944 9:14461496-14461518 CTCAAGTCTTTCTTCCACTGTGG + Intergenic
1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG + Intergenic
1056311597 9:85346803-85346825 TTGATGTTTTTGTTCCACTCAGG - Intergenic
1058441681 9:105014161-105014183 CTTCTGTTTTTGTTCCACTGTGG + Intergenic
1058875420 9:109239944-109239966 CTGATGCCTTTCTTCATCTGGGG - Intronic
1185987960 X:4857088-4857110 CTGAGGACTTTGATCATCTGAGG + Intergenic
1189143531 X:38632031-38632053 CTGATGACTGTGTTAAACTATGG + Intronic
1189756237 X:44274525-44274547 CTAATATCTTTTTTTAACTGAGG - Intronic
1190995140 X:55600351-55600373 CTCATGTCTTTCTTCAAATCTGG + Intergenic
1195453000 X:105036495-105036517 CTGATGCCTTTTTCCAAATGTGG - Intronic
1196649323 X:118152859-118152881 CTGCTGTCTTTGTTAGAGTGTGG - Intergenic
1197317710 X:124988573-124988595 GTGATGTCTTTGTTAAATTTGGG - Intergenic
1197740233 X:129886145-129886167 CTGATAGCTTTGTTCTCCTGGGG + Intergenic
1199446699 X:147932128-147932150 CTGATGTCATTGGTTAACTAAGG + Intronic