ID: 1172957649

View in Genome Browser
Species Human (GRCh38)
Location 20:38772526-38772548
Sequence AAGGGGAAAAAATAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1451
Summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 1297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172957649_1172957659 19 Left 1172957649 20:38772526-38772548 CCCTCCTCCTATTTTTTCCCCTT 0: 1
1: 0
2: 13
3: 140
4: 1297
Right 1172957659 20:38772568-38772590 CAGAAAGTTACCAGCATGTGAGG 0: 1
1: 0
2: 2
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172957649 Original CRISPR AAGGGGAAAAAATAGGAGGA GGG (reversed) Intergenic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900755846 1:4434084-4434106 AAGGGGGAAAAAAAGCAGCAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901285870 1:8078433-8078455 AAGGGGAAAGAATGGCAGGTTGG + Intergenic
901737121 1:11319675-11319697 AAGAGGAAAAATGAGGGGGATGG + Intergenic
901897294 1:12325072-12325094 AGGGGGAAAAAAAAGATGGAAGG - Intronic
902059412 1:13629637-13629659 AGTGGGAAAAAACAGGAGGTGGG - Intergenic
902733295 1:18383896-18383918 AAGGGGCAGCAATAGGATGAGGG - Intergenic
903108111 1:21102689-21102711 GAGGAGGAAAAATAGGAGGATGG - Intronic
903290143 1:22306140-22306162 AGGGGGAAAATAGAGGAGAAAGG + Intergenic
903331782 1:22600302-22600324 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
903345173 1:22679862-22679884 AGGGGGAAAAGATGGAAGGAAGG - Intergenic
905039334 1:34941421-34941443 AAGTGGAAAAAGTAGGGGAAAGG + Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905874188 1:41422015-41422037 AAGGGGGATAGATGGGAGGAGGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906364410 1:45194497-45194519 AAGGGGTAATATTAGTAGGAAGG - Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
906550077 1:46657810-46657832 GAGTGGAAAAAAAAGGAGAAGGG + Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
907190505 1:52644265-52644287 AAGGCAAAAAAAAAGGAGAAAGG + Intronic
907208921 1:52801157-52801179 AAGGGGGAAAAATAAGAAAAAGG + Intronic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
907341094 1:53736977-53736999 AAGGGAAAAAAAAAGGGGGGAGG + Intergenic
907535456 1:55151467-55151489 AAGGGGAGGAAGTAAGAGGAAGG + Intronic
907663425 1:56414248-56414270 ATGGGGAAAAAACAGAAGGTAGG - Intergenic
907699299 1:56767586-56767608 AAGGGGAGAAAAGAAGAGGCTGG + Intronic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
908900223 1:68947915-68947937 AAAGGGAAAAATAAGGGGGAAGG + Intergenic
909916996 1:81332882-81332904 AAGGGGAAAAAATAAAACAAAGG - Intronic
910116210 1:83734845-83734867 AAGGACAGAAAATAGGTGGATGG + Intergenic
910402047 1:86847277-86847299 TAGGGGAAAAGAGATGAGGATGG - Intergenic
910591709 1:88933378-88933400 AAAGGGAAAAGAGAGGAGGGAGG + Intergenic
910767478 1:90796682-90796704 AAGAGGAACAAAAAGGAGCAGGG - Intergenic
910869369 1:91818611-91818633 AAAGGAAAAAAATAGGATCAAGG + Intronic
911256885 1:95643461-95643483 AATGGGTGAAGATAGGAGGAGGG + Intergenic
911314488 1:96339586-96339608 CAGAGGAAAAGAGAGGAGGAAGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912127382 1:106555585-106555607 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
912227975 1:107757845-107757867 CAGGGGAAAAAAGAGGACTAGGG - Intronic
912663555 1:111557989-111558011 AAGGGGAAAAAATTGAATAAAGG + Intronic
912776700 1:112510066-112510088 GATGGGAAAGAATAGGAAGAAGG - Intronic
912942484 1:114057337-114057359 AAGGGGAAAAGAGTGGAGTAAGG - Intergenic
913120197 1:115732977-115732999 AAGGGGAAAAATAAAGATGAAGG + Intronic
913251825 1:116918206-116918228 AAGAGGAAAAAATAGGATTCAGG + Intronic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
914376176 1:147075889-147075911 AAGTGTTAAAATTAGGAGGAGGG + Intergenic
914506929 1:148297375-148297397 AAGTGTTAAAATTAGGAGGAGGG - Intergenic
914713874 1:150238221-150238243 AAGGGGAAAAGAGAAGAGGGAGG + Intergenic
914823643 1:151124951-151124973 AAGCAGAAAAGGTAGGAGGAGGG - Exonic
915021557 1:152784786-152784808 TAGGGGGAAACCTAGGAGGAGGG + Intronic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915310132 1:155002441-155002463 AAGGGGGCAAAAAAGGAGGGAGG + Intergenic
915475025 1:156148156-156148178 AAGGGAAGAAAATAGGGGCAGGG + Intronic
915630170 1:157147640-157147662 AAGGGGTCAAAATTGGAGGCAGG + Intergenic
915770542 1:158417860-158417882 ACATGGAAAAAATAAGAGGAAGG + Intergenic
915910820 1:159914164-159914186 GGGGGAAAAAAATGGGAGGAGGG - Intergenic
915954918 1:160213489-160213511 AAGGGGGAGGAAGAGGAGGAAGG + Exonic
916049018 1:161021773-161021795 AAGGGGAAAAAAAAGGGAAAGGG + Intronic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916271605 1:162948871-162948893 ACATGGAATAAATAGGAGGATGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916376887 1:164164966-164164988 AAGAGAAAAAAATAAGAGAAGGG + Intergenic
916400233 1:164439929-164439951 AAAGAAAGAAAATAGGAGGAAGG + Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
917077555 1:171220857-171220879 AAGGGGAAAAAAAAGTAAAAAGG + Intergenic
918203018 1:182284966-182284988 AAGGGGAAAACATGGGATGCAGG + Intergenic
918204457 1:182296842-182296864 AAGATGAAGAAATAGGAGAAGGG - Intergenic
918248170 1:182679044-182679066 CATGGGAAAGAATAGGTGGAAGG - Intronic
918453899 1:184687525-184687547 AAGGGGTGAGAATAGGAGAAAGG - Intergenic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
919103806 1:193124480-193124502 AAGGGGAAAGTGTAGAAGGAAGG + Intronic
919506732 1:198408192-198408214 AAGGGGAAAATGTAGGTGGCAGG - Intergenic
919586021 1:199441396-199441418 AAGGAGTAAAAAAAGGAAGAAGG + Intergenic
919862212 1:201747577-201747599 AGAGGGAATAAATAGGAGCAGGG - Intronic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920378536 1:205522502-205522524 AGAGGGGAAAAAGAGGAGGAAGG - Intronic
920525539 1:206663471-206663493 ATGGGGTAAAAACTGGAGGAAGG - Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920918896 1:210281541-210281563 AAAGGGAAAAGAGAGGAGAAAGG - Intergenic
921588744 1:216979050-216979072 AAAAGGCAAAAATGGGAGGAGGG - Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921740438 1:218678543-218678565 ATGAGGAAATAAAAGGAGGAAGG - Intergenic
921784408 1:219211360-219211382 AATGGGAAAAAAAAGGCAGAGGG - Intronic
921887478 1:220321361-220321383 AAGGGGAAAAGAAAACAGGAAGG - Intergenic
922155263 1:223036087-223036109 ATGGGGAGAAAATAGAAGGGGGG + Intergenic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922975064 1:229777631-229777653 AAGGGGAAGCAACAGGAAGAGGG + Intergenic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923051328 1:230393115-230393137 AAGGGGAAAAAAGAAGGGTAGGG + Intronic
923283818 1:232471205-232471227 AAGGGGATAAAATGGGAAGAAGG + Intronic
923393726 1:233540296-233540318 AAGAGAAAAAAATAAAAGGAAGG + Intergenic
923412754 1:233726023-233726045 GAGGGGACAGAAGAGGAGGAAGG + Intergenic
923630395 1:235645852-235645874 AGGGCGATAAAATAGGAAGAAGG - Intronic
923648050 1:235844755-235844777 AAGGGGACCAAAGAGGGGGAGGG + Intronic
923660688 1:235954664-235954686 AAGGGGCAATAACAGGAGAAGGG + Intergenic
923742564 1:236669116-236669138 AAAGGGAAAGGAAAGGAGGAAGG - Intergenic
923806519 1:237263929-237263951 AAGGGGAAAAAATAAGAGAAGGG + Intronic
923959526 1:239061626-239061648 AGGGGGAAAAAAAAGAATGAGGG - Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924366538 1:243299816-243299838 AAGGGGAACAAATAAGAGATAGG - Intronic
924443946 1:244111101-244111123 AAGGAGAGAAAAGAGGAGGGAGG + Intergenic
924693281 1:246373179-246373201 AAATGGAAAAAATAAAAGGAGGG - Intronic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1063580984 10:7306735-7306757 AGGGGGGAAAAAAAAGAGGAAGG + Intronic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063905859 10:10779481-10779503 GAAGGGAAAAAAAAAGAGGAAGG - Intergenic
1064665564 10:17647497-17647519 AAGGGAAAAAAAAAAGTGGAAGG - Intronic
1064927277 10:20582694-20582716 AAGCAGAGAAAGTAGGAGGAGGG - Intergenic
1064951232 10:20853252-20853274 AAGGTGAAAAAATTGGATGAAGG + Intronic
1065111278 10:22442473-22442495 AAAGGTACAAAATAGGAGGTAGG + Intronic
1065121133 10:22531325-22531347 AAGGGGGAGAAAGAGGGGGAGGG + Intergenic
1065259773 10:23912478-23912500 AAGGGGAAAAAGTAGGAGAGGGG - Intronic
1065286509 10:24192374-24192396 AAGGGGAAAGGATAAGGGGAAGG + Intronic
1065834590 10:29645265-29645287 GAGGGGGAAAAAAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066274846 10:33858548-33858570 AGGGGGAGAAAATGGGAGGAAGG - Intergenic
1066571424 10:36777140-36777162 AACGGGAAAAAAAAAAAGGAAGG - Intergenic
1066676240 10:37890385-37890407 AAAAAGAAAAAATGGGAGGACGG - Intergenic
1066676403 10:37892012-37892034 AAGAGGAAATAAAAGGAGTAAGG + Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1066798384 10:39152993-39153015 AAGAGTAAAAACTAGAAGGAAGG + Intergenic
1067061669 10:43081023-43081045 GATGGGAAAAATGAGGAGGAAGG - Intronic
1067267932 10:44763350-44763372 AATGGGGAAAGAAAGGAGGAAGG + Intergenic
1067546380 10:47195367-47195389 AAGGGGAAAACCCTGGAGGAGGG + Intergenic
1067607811 10:47682036-47682058 AGGGGGAAAAAAGAGGATCATGG - Intergenic
1067940773 10:50653828-50653850 AAGAGGAAAAGGTCGGAGGAGGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068326329 10:55492452-55492474 AAGGGTAACAAATACAAGGAAGG + Intronic
1068980927 10:63061382-63061404 ATGGGAAAAAAATAGGAGAAAGG + Intergenic
1069050874 10:63792218-63792240 TACTGCAAAAAATAGGAGGAGGG + Intergenic
1069692098 10:70360406-70360428 AAGGAGGAAGAAGAGGAGGAGGG - Intronic
1069718504 10:70535525-70535547 AGGAGGAAAGAAGAGGAGGAAGG - Intronic
1070006820 10:72432636-72432658 AAGAGGAAAAGAGAGGGGGAAGG + Intronic
1070565024 10:77597633-77597655 GAGGGGAAGGAATTGGAGGAGGG - Intronic
1070724108 10:78776614-78776636 AGGAGGAAAAAAGAGGGGGAAGG + Intergenic
1070984707 10:80678717-80678739 AAGGGGAAAGAGTGGCAGGAGGG + Intergenic
1071476741 10:86032016-86032038 AAGGGGAAAAGATGGGGTGAGGG - Intronic
1071720950 10:88145642-88145664 AAAAGGAAGGAATAGGAGGAAGG - Intergenic
1071820532 10:89275486-89275508 AGGTGGAAAAAATGGGAAGATGG - Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072012121 10:91311342-91311364 ACTGGGAGAAAATATGAGGAAGG + Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072320073 10:94240795-94240817 AAGGAGTAAAAATAGAAGAAAGG - Intronic
1072811707 10:98467500-98467522 AAGGGGGAGAGAAAGGAGGAGGG + Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072877734 10:99191048-99191070 AAGGGGAAAGAAGAAGGGGAAGG + Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073597763 10:104817532-104817554 AGGGGGAAAGAAGAGGAGGAGGG - Intronic
1074013124 10:109504634-109504656 AAGAGGAAATAATATGGGGATGG + Intergenic
1074129249 10:110558669-110558691 AAGGGAAGAAAAAAGAAGGAAGG + Intergenic
1074139032 10:110655271-110655293 AAGGGGAAAAAAAAGGGCGGGGG - Intronic
1074168958 10:110914062-110914084 AAGAGGAAACAATAGGTGGTAGG - Intronic
1074193431 10:111157996-111158018 AAGGGGAGAAAAGAAGAAGATGG - Intergenic
1074636844 10:115328578-115328600 AACTGGAGAGAATAGGAGGAGGG - Intronic
1074652451 10:115539642-115539664 AAAGAGAAAAAATGGGAGGGAGG - Intronic
1074657573 10:115611917-115611939 AAGGCCAAAAATTATGAGGAAGG + Intronic
1074889117 10:117720539-117720561 AAGGGGAGAAAGCAGAAGGAAGG + Intergenic
1075139194 10:119816302-119816324 AAGAGGAAAATGTAGGAAGAAGG - Intronic
1075468350 10:122669131-122669153 AAGGGGAAAAGATGGCTGGAAGG + Intergenic
1075731591 10:124639678-124639700 AAGGGGAAAATATAGAAAGGGGG - Intronic
1075833082 10:125427893-125427915 AGGGGGACAAAAGAGGAGGATGG - Intergenic
1076234358 10:128852339-128852361 AAGGGGAAAAAAGAGGTGCCTGG + Intergenic
1076326917 10:129631248-129631270 AAGGGTAGAAAATAGAGGGAGGG + Intronic
1076516149 10:131045451-131045473 AAAGGGAGAAGAAAGGAGGAAGG + Intergenic
1076666799 10:132097870-132097892 AAGGGAAGAAAATAAAAGGAAGG - Intergenic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1077955778 11:7019097-7019119 AAGAGGAACACAAAGGAGGAAGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078155595 11:8797457-8797479 AAGGGGAAGAAAGGGGAAGAAGG - Intronic
1078241401 11:9533988-9534010 AAGGGAAAAAAAAAAAAGGAGGG - Intergenic
1078324728 11:10370228-10370250 AAGAGCAGAAAATAAGAGGACGG - Intronic
1078469511 11:11575764-11575786 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
1078562559 11:12385905-12385927 ATGGGGAATAAAATGGAGGATGG - Intronic
1078811555 11:14772324-14772346 AAGGGGAAAAAATAGATGGAAGG + Intronic
1078841346 11:15078052-15078074 AGGGGAAAAAAAGAAGAGGAGGG - Intronic
1079022099 11:16917580-16917602 AAGGGAAGGAAATATGAGGAGGG - Intronic
1079124120 11:17706780-17706802 AAGGGGAAAAAAGATACGGAGGG + Intergenic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079358926 11:19754174-19754196 AAGGGGAAAAGTTGGGAGGAAGG - Intronic
1079539970 11:21561365-21561387 AAGGGGAAAAAATAGGTGTTGGG - Intronic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1079684698 11:23343832-23343854 AAGAAGAAAAAATAGGAAGATGG + Intergenic
1080878480 11:36297897-36297919 AAGGGGAAAAGAGAAGAGGCAGG + Intronic
1082022455 11:47546181-47546203 AAGGGAGAAAAATAGGAGAAAGG + Intronic
1082180243 11:49108233-49108255 AAAGAGAAAATAGAGGAGGAAGG - Intergenic
1082211917 11:49515261-49515283 AATGGGAATAAATAGCAAGATGG - Intergenic
1082305216 11:50564129-50564151 TAGGATAAAAAATAGGAAGAAGG - Intergenic
1082582431 11:54888995-54889017 CAGGATAAAAAATAGAAGGAAGG + Intergenic
1082588897 11:54980300-54980322 CAAGGGAAAAACTAGAAGGAAGG + Intergenic
1082709279 11:56534091-56534113 AAGGGGAAAAATTTGAAAGAGGG - Intergenic
1082849876 11:57754931-57754953 AAGAAGAAAAAAAAGAAGGAAGG - Intronic
1083041009 11:59687439-59687461 AAGGGAGAAAAAGAGTAGGAAGG + Intergenic
1083077271 11:60053983-60054005 AAATGGAAAAAATAGGGGGCCGG + Intergenic
1083095687 11:60248662-60248684 AAGGGGAAAATATAGATTGAAGG - Intergenic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083524991 11:63354811-63354833 AAGGGTAAAGGATTGGAGGAAGG - Intronic
1083771670 11:64871069-64871091 AAGGGGAAAAAAAGTCAGGAGGG + Intronic
1084406544 11:68977153-68977175 AAGGGGGAAGAAAAGAAGGAAGG + Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084887022 11:72217373-72217395 AAGGGGAAGAAATTGGAAGAGGG + Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085214661 11:74818254-74818276 AAGATGAATAGATAGGAGGAAGG + Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085246324 11:75104596-75104618 AAGGGGATGCAATAGGTGGAAGG + Intronic
1085703191 11:78763379-78763401 AAGGGGGAAAAAAAGAAGGGGGG + Intronic
1085849515 11:80103424-80103446 AAGGGGGAAAAAAGGAAGGAGGG - Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086071232 11:82802056-82802078 AAGGGGAAAAATTACAAGTATGG - Intergenic
1086156461 11:83672157-83672179 AAGGGGAAGAAAGGGAAGGAAGG - Intronic
1086322617 11:85666044-85666066 AAAGGAAAAAAAAATGAGGATGG - Intronic
1086322687 11:85666983-85667005 AAGGGGAAAATGTAGTTGGATGG - Intronic
1086637662 11:89109240-89109262 AATGGGAATAAATAGCAAGATGG + Intergenic
1086685247 11:89726599-89726621 AAAGAGAAAATAGAGGAGGAAGG + Intergenic
1086959501 11:92968167-92968189 AGGGGGGAAAAAAAGAAGGAAGG - Intergenic
1087055832 11:93935229-93935251 AATAAGAAAAAATAGCAGGAGGG - Intergenic
1087095673 11:94315081-94315103 ATGTGGCAAAAATAGAAGGAAGG - Intergenic
1087115033 11:94515588-94515610 AAAAGGAAAAAAAAGGAGAAAGG - Intergenic
1087124719 11:94613632-94613654 AAGGAGAAAAAATAAAAGGATGG - Intronic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087487975 11:98782586-98782608 AGGGGGAAAAAAAAGGAGCCCGG + Intergenic
1087612359 11:100449569-100449591 AAGGGGAATAAATACCAGGTGGG + Intergenic
1087781400 11:102304660-102304682 AAGAGGATAAAAGAGGAGGAGGG + Intergenic
1087837644 11:102890897-102890919 AAGAGGCAAGAAAAGGAGGAAGG - Intergenic
1087950759 11:104218457-104218479 AAGGGGACAGAAGAGCAGGAAGG - Intergenic
1088056885 11:105593631-105593653 AAGGGTAAAAAAGGGGAGGTTGG - Intergenic
1088226845 11:107629912-107629934 AAGAGGAAAGAATGGGAGCAAGG + Intronic
1088235787 11:107721298-107721320 AAAGGAATAGAATAGGAGGAAGG - Intergenic
1088518933 11:110673304-110673326 AAGAGGACAAAATATTAGGAAGG + Intronic
1088605027 11:111521170-111521192 AATGGGAAGAAATGGGAGAAAGG - Intronic
1088700991 11:112411509-112411531 AAGAGGAAAAAATATGAGACAGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089655586 11:119944538-119944560 ACGGGGAGAGAATAGAAGGAGGG + Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090085676 11:123648844-123648866 AAGGGGATGAAGTAGTAGGAGGG + Intronic
1090485719 11:127110349-127110371 GTGGAGAAATAATAGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090579730 11:128146636-128146658 GAGGGGGAAAAATAAGAGGTAGG + Intergenic
1090963854 11:131581241-131581263 AAGAGGAAAATAGAGGTGGAAGG - Intronic
1091113050 11:132988592-132988614 AAGGGGAACAAACAGGGCGAGGG - Intronic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1091580564 12:1785918-1785940 GAGGGGAAAAAAGAAGAGAAGGG - Intronic
1093087737 12:14885634-14885656 AAGGGGGAAGAAGAGGAGGAGGG + Intronic
1093278500 12:17159855-17159877 AAGGGAAGAAAATAAGAGGAAGG - Intergenic
1093416263 12:18924428-18924450 AAGGGGAGAGCATAGGAGGAGGG - Intergenic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1093572241 12:20679812-20679834 ATGGGGAAAAAAGAGGAAGATGG - Intronic
1093585481 12:20830375-20830397 AAAGGGGAAAAATAGGTTGAAGG + Intronic
1094034627 12:26054695-26054717 AAGGGAAAAAAATATTAGGAAGG + Intronic
1094071051 12:26413032-26413054 AAGGGTGAGAAACAGGAGGATGG + Intronic
1094169184 12:27473752-27473774 AAGGAGAAAAGTTTGGAGGAGGG - Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094868557 12:34571128-34571150 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1095153210 12:38819989-38820011 AAGAGGAAAAAAAAGAAGAAAGG + Intronic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095196872 12:39329562-39329584 AGAGGGAAAGAAGAGGAGGACGG + Intronic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095258818 12:40074689-40074711 AAGGGGGAAAAATGGGCTGAAGG - Intronic
1095275910 12:40282142-40282164 AAGGGGAAGAGAAAGGAGAAGGG - Intronic
1095373901 12:41503731-41503753 TTGGGGAAAAAATAGGTGAATGG + Intronic
1095579877 12:43785334-43785356 GAGGGGAAAAAATAGGGAGCAGG - Intronic
1095786878 12:46119593-46119615 AAGGGGAGAAACTTAGAGGAGGG + Intergenic
1095821340 12:46482016-46482038 AAGGGGAAAAAATTGGTTTAGGG - Intergenic
1096310328 12:50515076-50515098 AAAGGTAAGAAATAAGAGGAAGG - Intronic
1096421885 12:51465741-51465763 AAGGGGCTACAATGGGAGGAAGG - Intronic
1096525133 12:52206003-52206025 AAGAGGAAAAAATTGCAGCAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097426722 12:59454835-59454857 AGGGGGAAAAAGTGGGAGGGTGG + Intergenic
1097561391 12:61210391-61210413 AAGGGGAAGAAACAGGACTACGG - Intergenic
1097685250 12:62684932-62684954 AAGGGAAAAAAATAGGTACAAGG - Intronic
1097967145 12:65593604-65593626 AAGGGGAAAAAAAGTGAAGAAGG - Intergenic
1097975082 12:65676822-65676844 AGGGAGAAATAATAGAAGGACGG + Intergenic
1098442005 12:70528865-70528887 AAGGTGCAAAAGCAGGAGGAAGG + Intronic
1098656861 12:73042170-73042192 CGGGGGAAAAAATAAGAGTATGG + Intergenic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099028190 12:77491987-77492009 AAGGAGAAAAAATATGAGATAGG - Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099189499 12:79547882-79547904 AAGAGGGAAAGAAAGGAGGAGGG - Intergenic
1099438141 12:82668235-82668257 AAGGGGAAAAGAAAGAAAGAGGG - Intergenic
1099589300 12:84567117-84567139 ATGGAGAAAATATAGGAGGTTGG - Intergenic
1099591464 12:84596484-84596506 ATGGGGATAAAACAGCAGGAGGG - Intergenic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1099941984 12:89199560-89199582 AAAGAGACAAAATAGGAGTAAGG - Intergenic
1100316596 12:93450347-93450369 AGAGAGAAAAAATGGGAGGAGGG + Intergenic
1100347554 12:93747443-93747465 AAGAAGAAAAATTAAGAGGAAGG - Intronic
1100546061 12:95603721-95603743 AAAGGGAAGAAGTAGGAAGAAGG - Intergenic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101668723 12:106846256-106846278 AAGGGGAAGAAATAGGTTGGAGG - Intronic
1101690812 12:107078917-107078939 AAGGGGAAAGGCTATGAGGAAGG - Intronic
1101751997 12:107589577-107589599 AATGGGAAAAGATAGCAGAAGGG + Intronic
1101843203 12:108342277-108342299 AAGAGGAAGAAAGGGGAGGAGGG + Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102230251 12:111257257-111257279 AAGAGGAAAAGGGAGGAGGAGGG - Intronic
1102275650 12:111580178-111580200 AATGGGAAGAAAGAGGAGGCTGG + Intronic
1102275764 12:111580805-111580827 GAGGGGAAAAAAGGAGAGGAGGG + Intronic
1102429009 12:112867207-112867229 AAGGGGAGAAAAAAGCAGTAAGG - Intronic
1102463860 12:113116452-113116474 AATGGGAACACATGGGAGGAGGG + Intronic
1102548609 12:113674664-113674686 GAGGGAAAAAACTAGGAGAAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102764792 12:115423205-115423227 AGGGAGGAAAAAGAGGAGGAGGG + Intergenic
1102976086 12:117207966-117207988 AAGGGGAGAAGAGAGGAGAAGGG - Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103224483 12:119274939-119274961 TAGGGGAAAAAATAGAAGCTAGG + Intergenic
1104095899 12:125557757-125557779 AAGGGGAGAAAACAGGGTGATGG + Intronic
1104616374 12:130273354-130273376 AGGAGGAGAAAAGAGGAGGAGGG - Intergenic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105834159 13:24193582-24193604 AAGGGGCAGGAACAGGAGGAAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106243073 13:27925429-27925451 GAGGGGGAAGAAGAGGAGGAGGG - Exonic
1106931490 13:34670578-34670600 AAGGAGAAAAAAGAGGAGATGGG + Intergenic
1106948268 13:34853344-34853366 AAGAGGAAACATTACGAGGAAGG + Intergenic
1107123250 13:36818432-36818454 TAGGCGAAAGAATAGGATGAAGG + Intergenic
1107229568 13:38091830-38091852 AAAGGGAAAACAGAGGAAGAAGG + Intergenic
1107339250 13:39388593-39388615 ATGGGGGAAAATTATGAGGAGGG + Intronic
1107342960 13:39429463-39429485 ATAGGGTAAAAATAGAAGGATGG - Intronic
1107738283 13:43420950-43420972 AATGGGAAATAATAGGATTAAGG + Intronic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107908159 13:45081241-45081263 AAGGGAAATCAATAGGATGAAGG - Intergenic
1107938373 13:45363768-45363790 AAGGGGAAAATATGGAAGGGAGG - Intergenic
1108292348 13:48974776-48974798 AAGCAGAAAGAATAAGAGGAAGG + Intergenic
1108451280 13:50567201-50567223 GAACAGAAAAAATAGGAGGAGGG - Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108747741 13:53412140-53412162 AAATGGAAAAAATGGGAGGTAGG + Intergenic
1108895528 13:55322633-55322655 AATAAGAAAAAATAGAAGGAAGG - Intergenic
1109021741 13:57104633-57104655 AAGTGGAAAAGAGAGGAAGAAGG + Intergenic
1109523368 13:63542812-63542834 TAGGGGAAAAAAGAGAAGCAAGG + Intergenic
1109692964 13:65917417-65917439 GAGTGGAAAAAATATCAGGAAGG + Intergenic
1109693430 13:65923290-65923312 AAGGGAAAAAGAGAGAAGGAAGG + Intergenic
1110061667 13:71047681-71047703 AAGAGGAAAAAAGATAAGGATGG + Intergenic
1110088347 13:71411314-71411336 AAGGAGAAAAAAGAGGACAAAGG - Intergenic
1110146126 13:72192458-72192480 AAAGAGAAAAATCAGGAGGAAGG - Intergenic
1110659419 13:78041909-78041931 AAGGGTGCAGAATAGGAGGAAGG - Intergenic
1110893437 13:80718451-80718473 AAGCTTAAAAAATAGGAGCACGG + Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111306127 13:86414907-86414929 GAGGAGAGAAAACAGGAGGAGGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111752734 13:92355545-92355567 AAGGGGAAAAACAGGGAGCATGG - Intronic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1112049890 13:95634988-95635010 AAGGAAAAAAAAGAGGTGGAGGG - Intronic
1112157553 13:96834027-96834049 AAGAGAAAAAAATATCAGGAAGG + Exonic
1112163368 13:96892233-96892255 ACCCGGAAAAAATAGCAGGAAGG - Intergenic
1112588461 13:100741202-100741224 ATGGGCAAAAAAAAGGAGGTTGG - Intergenic
1112618818 13:101034405-101034427 AAGGGGAAGGAAGAGCAGGAAGG - Intergenic
1114388496 14:22280696-22280718 AAAAGGAAAAAAGAGGAGTAAGG + Intergenic
1114428517 14:22640361-22640383 AGGGGGAAAAAAGAGAAGGAGGG + Intergenic
1114463122 14:22900966-22900988 AAAGGGAGGAAATGGGAGGAAGG + Exonic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114987921 14:28252829-28252851 AAGGGGAGAAAAGAGTAGGATGG - Intergenic
1115568923 14:34648988-34649010 AAGTGGGAGAGATAGGAGGAGGG + Intergenic
1115742710 14:36404737-36404759 CAGAGGAAAAAATAGGCTGAAGG + Intergenic
1115795809 14:36934296-36934318 AAGGTGAAAAAATCTTAGGAAGG + Intronic
1115828843 14:37311344-37311366 AGGGAGAAAAGATAGGAAGAGGG - Intronic
1115899280 14:38126880-38126902 AAGTGGAGAAAATGGAAGGAGGG + Intergenic
1116960949 14:50968090-50968112 AAAAGGACAAAAAAGGAGGAAGG + Intergenic
1117218022 14:53571913-53571935 AGGGGAAAAAAATATGGGGAGGG + Intergenic
1117667837 14:58076070-58076092 AAGGAGGAGAAAGAGGAGGAAGG + Intronic
1118137784 14:63046916-63046938 AAGGCGAAAAGATAGTTGGATGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118806736 14:69244365-69244387 AAGGGGAAAAAAAGGAAGAAAGG - Intergenic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1120046675 14:79815565-79815587 AAGGCGAAGAAAGAGGAGGAGGG + Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120168255 14:81222608-81222630 AGGGGGGAAAACTAGGTGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120402580 14:84050670-84050692 AAGAAAAAAAAATAGTAGGAAGG + Intergenic
1120697506 14:87660105-87660127 AAGGGGAAAGCAGAGCAGGAAGG + Intergenic
1120712453 14:87806941-87806963 AACGGGAAAAAAAGGGAGGGAGG + Intergenic
1120717205 14:87852734-87852756 AGAGGGACAAAAAAGGAGGAAGG - Intronic
1120749861 14:88187309-88187331 GAGAGGAAAAGAAAGGAGGAAGG - Intronic
1121037161 14:90715909-90715931 AAGGAGAAAGGAGAGGAGGAAGG - Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121398375 14:93648350-93648372 AAGGGGTAAAAATGGAAGGAGGG + Intronic
1121747529 14:96310217-96310239 AAAGGGAATAAATAGTAGGCGGG + Intronic
1121908084 14:97765746-97765768 AAGGGGAGAAGAGTGGAGGAGGG - Intergenic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1122579473 14:102762446-102762468 ATGGGGGTAGAATAGGAGGATGG + Intergenic
1122647895 14:103207278-103207300 GAGAGGAGAAAAGAGGAGGAGGG - Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1123088556 14:105731161-105731183 AAGGGGGAAAAGCTGGAGGAGGG - Intergenic
1123887176 15:24737860-24737882 AAAGGCAAAAAATAAGTGGAAGG - Intergenic
1124552118 15:30691246-30691268 AAGGAGAAAGAATAGGGAGAAGG - Intronic
1124679123 15:31714420-31714442 AAGGAGAAAGAATAGGGAGAAGG + Intronic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125094614 15:35836828-35836850 AAGGGGAAAAAATGGCTTGATGG - Intergenic
1125119810 15:36141853-36141875 AGGAGGAAGAAAGAGGAGGAAGG + Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125543024 15:40482569-40482591 AAGAAGAAAACATAGGAGGAAGG - Intergenic
1125747045 15:42004367-42004389 AAAGGGAGAAAAAGGGAGGAAGG + Intronic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126407448 15:48335666-48335688 AAGGGGAAGAAAGAGAAGTATGG - Intronic
1126430206 15:48575489-48575511 AAGGTGAGAAGGTAGGAGGAGGG - Intronic
1126842356 15:52729603-52729625 AAGGGGTAGAAAGAGGAGAATGG + Intergenic
1127022238 15:54760734-54760756 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1127315273 15:57788954-57788976 AAGGGGAAGAAAGAGAAAGAGGG - Intergenic
1127653613 15:61034240-61034262 AAGGGGGAAAAAGAGGAAGCAGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128408586 15:67369520-67369542 AAGGGGAAAGAAGGGAAGGAGGG + Intronic
1128698172 15:69784450-69784472 AGGGGGAAAGAGTAGGAAGAGGG - Intergenic
1128844491 15:70878433-70878455 AAGGGGAAAAAAAGGAAAGAAGG - Intronic
1129334437 15:74843798-74843820 GAGGGGAAAAAATACCAGAAAGG + Exonic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1129889067 15:79059130-79059152 GAAGGGAAAAGAAAGGAGGAAGG - Intronic
1130106249 15:80930824-80930846 AAGAAGAAAAAATAGAAAGATGG - Intronic
1130112725 15:80979283-80979305 AAGGGCAAAAAAAAGAAGGAAGG - Exonic
1130803070 15:87287112-87287134 GAGGGGAAAAGAAAGAAGGAAGG + Intergenic
1131305639 15:91240792-91240814 AAGGGGGAAACATAGGGGAACGG - Intronic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131385124 15:91999425-91999447 ATGGGTATAAAATAGGAAGAGGG + Intronic
1131437382 15:92434220-92434242 AAGGGAAAAAAAAAGAAAGAGGG - Intronic
1131696619 15:94883403-94883425 AAAGGGAGAAAATGGGAGAAAGG - Intergenic
1132225163 15:100134679-100134701 AAGGGATAAAAATAAGAGAAAGG + Intronic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133445072 16:5852831-5852853 AAGGGGAAAAAAAAGGATTTGGG + Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133668111 16:7990690-7990712 AAGGGGAAATAAACAGAGGATGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134449341 16:14354068-14354090 AAGGGGAAGAAATGGGAGGAGGG + Intergenic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1135092774 16:19533437-19533459 AAGGGGAGAGAACAGCAGGAGGG + Intronic
1135547808 16:23377557-23377579 GAAGGGAAAAGAGAGGAGGAAGG - Intronic
1135549685 16:23388459-23388481 AGGGGGAAAAAAAAAGAAGAAGG + Intergenic
1135759821 16:25128449-25128471 GAAGGGAGAAAAAAGGAGGAAGG - Intronic
1135885681 16:26304894-26304916 AAGAGGAAAAACCAGGAAGAGGG - Intergenic
1136625735 16:31461226-31461248 ATGGGGAAAGAATAGGAAGGGGG - Intronic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137956989 16:52841665-52841687 AGGGGGCAGAAATGGGAGGAGGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138120775 16:54399407-54399429 AGGGGGAAAAAATTAGAGTAGGG + Intergenic
1138247558 16:55479055-55479077 AAGAGGAGAAAAGTGGAGGAGGG + Exonic
1138690066 16:58758915-58758937 AAGGTGAGAGGATAGGAGGAGGG - Intergenic
1138946543 16:61858136-61858158 GAGGGGGAATAAGAGGAGGAAGG + Intronic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139056765 16:63195098-63195120 AAGGGGAAAAGATCACAGGATGG + Intergenic
1139245592 16:65439401-65439423 AAGGGGAAAAAAGAGATGAATGG - Intergenic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139416417 16:66814859-66814881 AAGGGGGAAAAGTGGTAGGAAGG - Intronic
1139419305 16:66840259-66840281 TGGGGGAAAGAATAGAAGGAGGG + Intronic
1140276651 16:73514892-73514914 GAGAGGAAAAGATGGGAGGAGGG - Intergenic
1140347605 16:74229041-74229063 AGAGGGAAAAAATATGGGGATGG + Intergenic
1140770593 16:78200366-78200388 AATAGGAAAAGAAAGGAGGAAGG + Intronic
1140775581 16:78246350-78246372 AAGGGGAAAAAAAAGGTAGGAGG - Intronic
1141393188 16:83681548-83681570 AAGGGGAGAAGAACGGAGGAGGG - Intronic
1141472217 16:84246828-84246850 AACTGGAATAAACAGGAGGAAGG + Intergenic
1141485215 16:84334255-84334277 AAGGGGAGGAAAGAGCAGGAAGG + Intergenic
1141620385 16:85234181-85234203 AAGGGGCAAATATAGGAGGGCGG - Intergenic
1141882221 16:86867646-86867668 ATGGGGAGAAAATAGGTGTAGGG - Intergenic
1141932492 16:87215407-87215429 AAGAGGGAAAAAAAAGAGGAGGG + Intronic
1142251482 16:88993875-88993897 AAGGAGAAAAAAAGGGAGGGAGG - Intergenic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142477338 17:196895-196917 AAAGAGAGAAAAGAGGAGGATGG + Intergenic
1143229119 17:5336702-5336724 AACAGGAAAAAAAAGGAGGGAGG - Intronic
1143313731 17:6015166-6015188 AAGAGGGAAAAATAAAAGGATGG + Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144277106 17:13681275-13681297 GACTGGATAAAATAGGAGGAAGG - Intergenic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1144889110 17:18483817-18483839 AAGGGGAGCAAACAGGAGGCCGG + Intronic
1144969414 17:19098211-19098233 AAGGGGAAAAAAGAGGGGGGTGG + Intergenic
1144978502 17:19153853-19153875 AAGGGGAAAAAAGAGGGGGGTGG - Intronic
1144989720 17:19224380-19224402 AAGGGGAAAAAAGAGGGGGGTGG + Intronic
1145143099 17:20460479-20460501 AAGGGGAGCAAACAGGAGGCCGG - Intronic
1145221623 17:21094198-21094220 GAGGGGGAGAAAGAGGAGGAGGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1146567330 17:33924636-33924658 AAAGGGAGAAAATGGGATGAAGG - Intronic
1146619305 17:34385195-34385217 AAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1146733779 17:35219170-35219192 ATGAGCAAAAAATAGCAGGAGGG + Intergenic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147356036 17:39897560-39897582 AAGGTGAAAAAACAAGAGAATGG - Intergenic
1147800202 17:43079962-43079984 AAGGAGAAAAAAAAGCAGAAAGG - Intronic
1148112540 17:45154128-45154150 AAAGTGAAGAAATAGGAGGCCGG - Intergenic
1148137602 17:45304639-45304661 ATGGGGAAAAAATGGGTAGATGG + Intronic
1148228190 17:45914044-45914066 AAAGGATAAAAAAAGGAGGAGGG + Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149340842 17:55684752-55684774 ATGGGGACAAAAGTGGAGGATGG - Intergenic
1149403105 17:56319085-56319107 AAGGAGGAAGAAGAGGAGGAGGG + Intronic
1149500577 17:57149313-57149335 GAGGGGAAAAATGAGGGGGAAGG + Intergenic
1149836733 17:59919837-59919859 TAGAGGAAAAATTAGAAGGAAGG - Intronic
1150146431 17:62773488-62773510 AAGGGGAAGAAATAAGTGGAGGG + Intronic
1150402535 17:64870816-64870838 AAGGAAAGAAAATAGAAGGAAGG - Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151121274 17:71796033-71796055 AGGGGGAAAAAAGAGAATGAAGG + Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1151518100 17:74609945-74609967 TAGGGGAAAAAAAGGGAGTAAGG + Exonic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152105187 17:78324594-78324616 AAGGGGAAAAAAAGGGAGGGAGG - Intergenic
1152552546 17:81036889-81036911 AAGGAGAAAAAATAGGAAAAAGG - Intronic
1152598463 17:81249541-81249563 AGGAGGAAAAAAGAGGGGGAGGG + Intronic
1153488363 18:5624942-5624964 AAGGTGAAGAAAGGGGAGGAAGG + Intronic
1154205760 18:12335456-12335478 AAGGGGAAAGAGTGGCAGGAAGG - Intronic
1154391264 18:13938267-13938289 AAGGGGAAAAAATGGGATCCAGG - Intergenic
1155122235 18:22833203-22833225 AAGGAGAAAATATAGCATGATGG - Intronic
1155259564 18:24028140-24028162 AGGGGAAAAAAAAAGGAGGTGGG + Intronic
1155303152 18:24451878-24451900 GAGGGGAAAAAATGGGGGGGAGG - Exonic
1155306425 18:24483168-24483190 ACGGGCAAGAAATAGGAAGATGG - Intergenic
1155362256 18:25015385-25015407 ACAGGGAAAAAAAAGTAGGATGG - Intergenic
1155479861 18:26273693-26273715 GAGGGTAAAAAATGGGAAGAAGG - Intronic
1156019424 18:32582915-32582937 GAGGGGGAAAAAGAGGAGGAGGG - Intergenic
1156055653 18:32999259-32999281 AAGGGGAGGAAAGAGGGGGAAGG + Intronic
1156294631 18:35778386-35778408 AGGGGGAAAAAAGAGTTGGAAGG - Intergenic
1156438808 18:37163359-37163381 AGGAGGAACAAAAAGGAGGAAGG - Intronic
1156533242 18:37838409-37838431 GGGGGGAAAAAAAAGGTGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157084532 18:44565750-44565772 AAGAGAAAAAAATAAAAGGAAGG + Intergenic
1157150417 18:45211616-45211638 AAGGAGAAAAAAGCAGAGGAGGG - Intergenic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157436512 18:47674601-47674623 CAGGAGGAAAAATAGGAGTATGG + Intergenic
1157575812 18:48742291-48742313 TAGGGGAAAAGAAAGGAGCAGGG + Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157723701 18:49945875-49945897 ATGGGGAAATAATGGGAGGCTGG + Intronic
1158281944 18:55838124-55838146 AGGGGGAAGAAACAAGAGGAAGG + Intergenic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1158623313 18:59050800-59050822 AAGGGGAAGAATCAGGAGTAAGG - Intergenic
1158811017 18:61034559-61034581 AAGGGGAAAAAAGATCATGAAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159266561 18:66087879-66087901 AAGGGGGAAAAATCAGAGGCAGG - Intergenic
1159332717 18:67020298-67020320 AAGGGAAGAAAACAGCAGGATGG - Intergenic
1159896438 18:74001363-74001385 AAGGGGAGGAAAAAGTAGGAAGG - Intergenic
1159923523 18:74247107-74247129 ATGGGGAGACAATGGGAGGATGG - Intergenic
1159933089 18:74334324-74334346 AAGGGGAGAAAAGAGGAGGAGGG + Intronic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1161207099 19:3046991-3047013 AGGGAGAGAAAATAGCAGGAAGG - Intronic
1161403853 19:4081071-4081093 AAAGGGAAAAGAGGGGAGGAGGG + Intergenic
1161415686 19:4145303-4145325 ATGGGGAAAGAAGGGGAGGAGGG + Intergenic
1161606658 19:5218826-5218848 AAGGGGGAAAAAAAGAAGAAAGG + Intronic
1161666205 19:5578598-5578620 AAGGGGAGAAAAAAGAGGGATGG - Intergenic
1161841086 19:6680819-6680841 AATGGGAAGAAATAAGAGAAGGG + Intronic
1161994222 19:7702617-7702639 AAGGGGAAAAAAAAGACAGAAGG + Intergenic
1162784629 19:13026780-13026802 AAGGGGAAAAAATACTGGAATGG - Intronic
1162863632 19:13527055-13527077 AAGAGGAAGAAATGGAAGGAAGG - Intronic
1163465780 19:17467854-17467876 AAGGGGGGAAGAGAGGAGGAGGG + Intergenic
1164207780 19:23072192-23072214 AGGAGGAAAAAAAGGGAGGAAGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164494209 19:28744565-28744587 AATGGGGAAAAAAAGGAGGGAGG - Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164680392 19:30130722-30130744 AAGGGGGAGGGATAGGAGGAGGG - Intergenic
1165563957 19:36707121-36707143 AATTGGAAAAAATAGGAAGATGG - Intronic
1165788727 19:38478028-38478050 GAGGAGGAAAAAGAGGAGGAGGG - Intronic
1166226535 19:41399173-41399195 TAGGGGAACAAACGGGAGGAGGG + Intronic
1166408269 19:42539393-42539415 AAGGGGAAGGAAGAGCAGGAAGG - Intronic
1166474307 19:43108294-43108316 AAAGGGAAGAAATAGGCTGAAGG + Intronic
1166488272 19:43233370-43233392 AAAGGGAAGAAATAGGCTGAAGG + Intronic
1166494946 19:43293848-43293870 AAAGGGAAGAAATAGGCTGAAGG + Intergenic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1166863140 19:45821161-45821183 AAGGGTAAAACCTGGGAGGAAGG + Intronic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1167028606 19:46941043-46941065 AGAGGGAAAAAAAAGGAGGGTGG - Intronic
1167181100 19:47904000-47904022 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167181768 19:47909359-47909381 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167182418 19:47914749-47914771 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183085 19:47920101-47920123 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183753 19:47925451-47925473 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167184383 19:47930501-47930523 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185055 19:47935852-47935874 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185707 19:47941241-47941263 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167186374 19:47946599-47946621 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187025 19:47951987-47952009 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187675 19:47957370-47957392 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167191333 19:47991893-47991915 AAGATGAAAGAAGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167542166 19:50096262-50096284 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167542601 19:50099327-50099349 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543038 19:50102392-50102414 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543474 19:50105455-50105477 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544147 19:50110799-50110821 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544822 19:50116152-50116174 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167545497 19:50121504-50121526 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546174 19:50126832-50126854 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546851 19:50132167-50132189 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167547509 19:50137540-50137562 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1168141230 19:54388667-54388689 AGGGGGAGAAACTTGGAGGAGGG - Intergenic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168479427 19:56706593-56706615 AAGGGGAAAATATGGGAGAAAGG + Intergenic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
1202672058 1_KI270709v1_random:64181-64203 AAGAGGAAAAGAAAGGAAGAAGG + Intergenic
1202709563 1_KI270714v1_random:10212-10234 TACGGCAAAAAATAGGAGAAGGG - Intergenic
925317017 2:2934286-2934308 AAAGGGAAGAAAGGGGAGGAAGG - Intergenic
925436889 2:3846203-3846225 AAGAGGGAAGAACAGGAGGACGG - Intronic
925625903 2:5841966-5841988 AAGGGAGAAATAAAGGAGGAGGG + Intergenic
925763927 2:7212734-7212756 CTGAGGAATAAATAGGAGGAAGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
925849544 2:8067516-8067538 AAGAAGGAAAAAAAGGAGGAGGG + Intergenic
925908729 2:8557239-8557261 TAGGGGAAAAAAAAGGGGGGTGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926384526 2:12323295-12323317 AATGGAAAAAAAAAGGAGCAGGG - Intergenic
926421017 2:12699410-12699432 AAGGGGGAGAAAAAGGAGAAGGG + Intergenic
926609543 2:14932167-14932189 AGGGGATAAAAATAGGATGAGGG - Intergenic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
927352486 2:22133704-22133726 GAAAGGAAAGAATAGGAGGAAGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927733535 2:25497558-25497580 AGGGTGAAAAAATAGGACGATGG + Intronic
928572759 2:32625557-32625579 AAGGAGAAAAAATAGGAAGGAGG - Intergenic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
929186663 2:39102362-39102384 AAGGGGAAAAAAAATTAGGTGGG + Intronic
929250299 2:39746859-39746881 AAGGAACAAAAATAGGAAGAAGG - Intronic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929685166 2:44027080-44027102 AAAGGGAAAGAATAGAGGGAAGG + Intergenic
929702529 2:44176227-44176249 AAGGTGGAACAATAGGAGAAGGG + Intronic
929955108 2:46451836-46451858 AAGGGGAAAGTTTAGGAGGGCGG + Intronic
930131019 2:47850887-47850909 TAGGGGAACAAATATGAGAATGG - Intronic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
931123192 2:59244046-59244068 AAGGGGAAAGGAAAGAAGGAAGG + Intergenic
931613002 2:64124141-64124163 AAGGGGAGAAAATAGGAAATTGG + Intronic
932049608 2:68385561-68385583 AAAAGGAAATAAGAGGAGGAGGG - Intronic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932627133 2:73306782-73306804 AAGGGAAAATAATAGAAAGAAGG + Intergenic
932695925 2:73956496-73956518 AAGGGGAAAAACTGGAAGGAGGG + Intronic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
933035333 2:77389786-77389808 AGGAGGAAAAAAGAGGACGAAGG - Intronic
933379998 2:81530338-81530360 AATGGGAAAAAAGAGGAGCTGGG - Intergenic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935548495 2:104426146-104426168 TGGGGGAAAAAGTAGAAGGAAGG - Intergenic
935897663 2:107755151-107755173 AAGAGGAAAAGACAAGAGGAAGG - Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936248370 2:110848226-110848248 AAGGGGAAAAAAGGGCAGAAAGG - Intronic
936606898 2:113967695-113967717 AAGTGGAAAAAACAGGATAAAGG - Intergenic
936769995 2:115900746-115900768 AAAGAGAAAAAATAAGAGAAGGG - Intergenic
936959807 2:118061293-118061315 ATGTGGAAAGCATAGGAGGAGGG - Intergenic
937169570 2:119852066-119852088 AAGGTAACAAAATAGGAGAAAGG - Intronic
937747771 2:125435275-125435297 AAGGGGCAAAAATTGAAGCAAGG - Intergenic
938239632 2:129733330-129733352 AAGGAGCACAAACAGGAGGAGGG - Intergenic
938936099 2:136128829-136128851 GAGGAGGAAAGATAGGAGGATGG - Intergenic
938941631 2:136174815-136174837 AAAGGGTGACAATAGGAGGAAGG + Intergenic
939175171 2:138739872-138739894 GAGGGAAAAAAATAGAAGTAGGG + Intronic
939287209 2:140147545-140147567 AAGGGCACAAAAGATGAGGAGGG + Intergenic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
939720598 2:145645497-145645519 AAAGGAAAAAAAAAGGAGAAAGG + Intergenic
939845815 2:147245020-147245042 AAGGTGAAAAAGTAGAATGATGG + Intergenic
939987517 2:148845208-148845230 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
940736788 2:157462645-157462667 AAGAAGAAAAAGTAGCAGGAGGG + Intronic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941505538 2:166339428-166339450 GATATGAAAAAATAGGAGGAGGG + Intronic
941569443 2:167151797-167151819 AAGGAGAAAAACTAGGTGCATGG + Intronic
941958105 2:171225447-171225469 AAGGGGAAAAAAAAGGAAAAAGG + Intronic
942378840 2:175365752-175365774 TCGGGGAGAAAGTAGGAGGAAGG + Intergenic
942418028 2:175779083-175779105 AAGGGGCAAAAGTAGAAGTAGGG + Intergenic
942634704 2:177990748-177990770 AAAAGGAAAAAAAAGGCGGAGGG + Intronic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
942704293 2:178751503-178751525 AAGGGGAGAAGATAGGATAAAGG - Intronic
943206040 2:184897332-184897354 AAGGGGAAAAAATTGCTGTATGG - Intronic
943206059 2:184897436-184897458 AAGGGGAAAAAATTGCTGTATGG - Intronic
943330749 2:186556248-186556270 AAGGAGAAAAGAAAGAAGGAAGG - Intergenic
943913173 2:193593807-193593829 AAGAGGAAGAAAGAGCAGGAAGG + Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944046232 2:195414508-195414530 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
944337724 2:198556924-198556946 AATGTGAAAGAAGAGGAGGAAGG - Intronic
944523111 2:200591311-200591333 CATGGGAACAAAGAGGAGGATGG + Intronic
944732648 2:202533219-202533241 AAGAAGAGAAAAGAGGAGGAAGG - Intronic
945189494 2:207172113-207172135 CAGGAGAGAAAATAGGAGTAGGG - Intergenic
945326473 2:208488025-208488047 CAGGGGCAAAAATAGCAGGAGGG + Intronic
945550657 2:211218059-211218081 CAGGGGAAAGGATAGGAGGTGGG + Intergenic
945610377 2:211993504-211993526 AAGAAGAAAAGATAGGAAGAAGG + Intronic
945680558 2:212908959-212908981 AAAGGGAAAGAATTGGAAGATGG - Intergenic
945686686 2:212979592-212979614 AATGAGAAAAAATAAAAGGAGGG + Intergenic
946272541 2:218606253-218606275 AAGGGGACACATTAGGAGGGAGG - Intergenic
946274713 2:218622226-218622248 AATGTGAGTAAATAGGAGGAGGG + Intronic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
946973688 2:225123408-225123430 AAGGAGGAAAGATGGGAGGAAGG - Intergenic
947103209 2:226643686-226643708 AAAGGGAAAAAAAAGGAGGGGGG + Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947652372 2:231797789-231797811 TAGTGGGGAAAATAGGAGGAGGG + Intronic
947671115 2:231936046-231936068 AAGGAGGAAAAAGAGAAGGAAGG - Intergenic
947752081 2:232538446-232538468 AAAGGGAGAAAACAGGAGGGTGG + Intergenic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948861694 2:240755700-240755722 AAGGGGAAAAAAATGTTGGAAGG + Intronic
948939188 2:241187715-241187737 GAGGGGGAGAAACAGGAGGAGGG + Intergenic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1169244327 20:4014258-4014280 AAGGGGAAAAAAAAGCAAGGAGG + Intronic
1169539764 20:6586686-6586708 AAGGGGAAAGGAAAGGAAGAAGG + Intergenic
1169628675 20:7600664-7600686 GAGGGGAAAAAAGAGTGGGAAGG + Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1169709755 20:8548238-8548260 AAGGGTGAAAAAGAGGAAGAGGG - Intronic
1169859655 20:10137862-10137884 AAGGGGCAAAACTAAGAGAATGG + Intergenic
1169998317 20:11584598-11584620 GAGGGTGAAACATAGGAGGAGGG - Intergenic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170236093 20:14106321-14106343 AAGGGGAAGGAAGAGAAGGAAGG + Intronic
1170270336 20:14520604-14520626 AAGATGAAAAACTAGGAGCAAGG - Intronic
1170731103 20:18975442-18975464 AAGGGAGAAAAAGAGGAAGAGGG - Intergenic
1171077455 20:22143038-22143060 AGGGAGAAAAAATAGAAAGAGGG - Intergenic
1171077764 20:22146708-22146730 AAGAGGAACAAATAGCAAGAGGG + Intergenic
1171945342 20:31371833-31371855 AAGGGGGAAGAGTAAGAGGAGGG - Intronic
1172062166 20:32193985-32194007 AAGGAGAAAAGACAGGAGGTGGG + Exonic
1172073285 20:32274721-32274743 CAGGGGAAAAAAAAATAGGAGGG + Intergenic
1172133403 20:32671539-32671561 AAAGGGAAAAAATAGTAGAATGG + Intergenic
1172246241 20:33446932-33446954 AAGGGGAAAAAAAGGGAGAGAGG + Intergenic
1172329276 20:34063729-34063751 AAGGGGATCAAAGAGGAGAAAGG + Intronic
1172512516 20:35510271-35510293 AAGGGAAAGGAATAGGAAGAGGG + Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172930019 20:38579831-38579853 AACAGGAAAAAATAAGAGCATGG - Intergenic
1172953021 20:38734137-38734159 AAGGAGGAAGAAGAGGAGGAGGG - Intergenic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1173618273 20:44416910-44416932 AAGGAGAAAAGGTGGGAGGAAGG - Intronic
1173953917 20:47016146-47016168 AGGGGGAAAAAAAAGGACCAAGG - Intronic
1174063663 20:47849583-47849605 AAGGGGAAAAGAAGGGAGGGGGG - Intergenic
1174166098 20:48584562-48584584 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174405324 20:50299067-50299089 AGGAGGAAAAAGCAGGAGGAGGG + Intergenic
1174649883 20:52115741-52115763 AAGGGGAGAAGTTTGGAGGAAGG + Intronic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174763536 20:53230010-53230032 GAAGGGAAAAAAGAGAAGGAAGG + Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175269757 20:57725504-57725526 AAGGGAAAGAAATAGGGTGATGG - Intergenic
1175273990 20:57754904-57754926 GAAGGAAAAAAAAAGGAGGAAGG - Intergenic
1175310199 20:58006556-58006578 AAGGGAGAAATATAAGAGGAGGG + Intergenic
1175531014 20:59674364-59674386 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175531033 20:59674430-59674452 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1176197526 20:63844337-63844359 AAAGGGAAAACCTAGGATGAGGG + Intergenic
1176998522 21:15583455-15583477 AAGGGTACAAAATAGAAGAAGGG - Intergenic
1177179863 21:17733479-17733501 GAGGGGAGAAAATAAGATGAAGG + Intergenic
1177442712 21:21148053-21148075 AATAGGAGAAAATGGGAGGAAGG - Intronic
1177506157 21:22020115-22020137 AAAGAGAAAAAAAAGAAGGAGGG + Intergenic
1177568304 21:22852423-22852445 AGCAGGAAAAAATAGGAGGTGGG + Intergenic
1177718355 21:24870378-24870400 AAGGGTAAAAAATAGGATCGTGG + Intergenic
1178089949 21:29151544-29151566 AAGAGGAAAAAATATGACTAGGG - Intronic
1178318742 21:31588687-31588709 AAAGAGAAAAAATAGAAGGTGGG + Intergenic
1178376764 21:32073834-32073856 AAGGGGAGAAAATAGAGGAAGGG - Intergenic
1178379144 21:32093586-32093608 AAAGGGAAAGGATAAGAGGAAGG - Intergenic
1178427463 21:32490511-32490533 AAGGGGAGAAAATGGAAGGAAGG + Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178599634 21:33984617-33984639 GAGGGGCATAAATAGTAGGAGGG + Intergenic
1178742895 21:35219666-35219688 AAGAGGAAACAATAAAAGGAAGG + Intronic
1178753484 21:35325906-35325928 AAGGTGAAAAGAGTGGAGGATGG + Intronic
1179000332 21:37451900-37451922 AGGAGGAGAAAATAGGAGGGCGG + Intronic
1179274924 21:39883426-39883448 AAAGGGAAAATACAGGAGGAGGG - Intronic
1179384706 21:40931070-40931092 AAGTGGAGAGAATTGGAGGACGG + Intergenic
1179533248 21:42034341-42034363 AAGGGGAAAAAAGCAGAGAAGGG - Intergenic
1180413377 22:12637178-12637200 AAGGAAAAAAAAGAGGGGGAGGG + Intergenic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1181324892 22:22037107-22037129 AAGAGGGAAGAGTAGGAGGAAGG + Intergenic
1181373039 22:22432800-22432822 AAATGGAAAAAGTAGGATGATGG - Intergenic
1181536813 22:23550571-23550593 CAGAGGAATAAATAGGAGGATGG - Intergenic
1181886062 22:26023418-26023440 AAGGCATAAAAGTAGGAGGAAGG - Intronic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183129425 22:35819801-35819823 ACAGAGAAAAAATAAGAGGAGGG + Intronic
1183274057 22:36880374-36880396 AAGAGGAAAAAATACGAGCGGGG + Intergenic
1183401514 22:37607886-37607908 AGGGAGAAAAAGTAGGATGAAGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184449778 22:44576025-44576047 GAGGGGGAAAAAGAGGAGGAGGG + Intergenic
1185046812 22:48532704-48532726 AAAGGGGAAGAAGAGGAGGATGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949305930 3:2640976-2640998 AAGAGAAAAAAATTGGAGGGAGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949505722 3:4725443-4725465 AAGGACAAAACACAGGAGGAAGG - Intronic
949650292 3:6150396-6150418 AAGGGGAAAAAAAAGAAGACTGG - Intergenic
949710246 3:6862885-6862907 ACGGAGAAAAAATGGGAGGAAGG + Intronic
950873081 3:16245972-16245994 AAGAGGGAAAAAGAGGAGGTGGG + Intergenic
950942638 3:16908984-16909006 TACGGGAAAAAATAGAAAGAAGG - Intronic
951088464 3:18542769-18542791 AAGGGGAAAAAATAGAGGCAAGG + Intergenic
951162839 3:19446785-19446807 AGGGGGAAGAAAAAGGAGAAAGG + Intronic
951252238 3:20407416-20407438 AAATGGAAAAATGAGGAGGAAGG - Intergenic
951417352 3:22441153-22441175 AAGGGGTGAAAATGGGAGGCAGG - Intergenic
951510862 3:23500695-23500717 AGGGGCAAAAAAGAGGAGGGAGG - Intronic
951846850 3:27093745-27093767 AAGTGGAAAAAATATGGGAATGG + Intergenic
952008836 3:28875725-28875747 AAGGAGAAGAAATAGTGGGAAGG - Intergenic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952814377 3:37434535-37434557 GAGGGGAAAAAATAAGGGGGAGG - Intronic
953049845 3:39331042-39331064 AAGGGAGAAAAAAAGAAGGAAGG + Intronic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954935548 3:54323420-54323442 AAGGAGAGAAAAGAGGGGGAAGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955501577 3:59589882-59589904 AAGGGGAAAACATGGTTGGAGGG + Intergenic
955532742 3:59891236-59891258 AAGGACACAAAATATGAGGAAGG + Intronic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
955660124 3:61289865-61289887 GAGGAGAAGAAATAGGACGAAGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956730932 3:72195910-72195932 AACAGGAAAAAATTGGAGGCTGG + Intergenic
956871223 3:73420247-73420269 AAGGGGAACAAAACAGAGGATGG - Intronic
956924846 3:73973494-73973516 AAAGGGATAAAATTGGAGGAGGG - Intergenic
957005380 3:74939610-74939632 AAGGAGAATAAATAGTAAGACGG + Intergenic
957387675 3:79518418-79518440 AAGGGGAAAGAAAAGAAGCACGG - Intronic
957621964 3:82604972-82604994 AAGGGGAAGGAATAGTAGGGAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958144990 3:89612538-89612560 AAGGAGAAAAAAAGGAAGGAAGG - Intergenic
958182991 3:90083923-90083945 AGGGGGATACAAGAGGAGGATGG - Intergenic
958439866 3:94143139-94143161 AAGAGGATATAATAGGAGGGTGG + Intergenic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
958862544 3:99462475-99462497 ATAGAGAATAAATAGGAGGATGG + Intergenic
958867652 3:99519655-99519677 AAGGGGAAGGCAGAGGAGGAGGG + Intergenic
959024202 3:101221688-101221710 AAAGAAAAAAAATAGGAGGGTGG - Intergenic
959034672 3:101346992-101347014 AGGAGGAAGAAAGAGGAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959448234 3:106466974-106466996 AAGGGGAGAGAATAGTGGGAAGG - Intergenic
959583859 3:108007824-108007846 AAGGGGAAAAAATGGGAATGAGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959883555 3:111473742-111473764 CAGGGGAAAAAATAGCAGACTGG + Intronic
959965206 3:112346282-112346304 AAAAAGAAAAATTAGGAGGAAGG - Intronic
960061546 3:113328035-113328057 ATGGTGAAGAAATAGGTGGAAGG - Intronic
960246226 3:115403308-115403330 AAAGGGAAAAAAAGGGAGGGTGG + Intergenic
960273447 3:115699541-115699563 AATGGGAGGAAAGAGGAGGAGGG - Intronic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
960526253 3:118714331-118714353 AAGGGGAAAAAATAGAAAAATGG - Intergenic
960672106 3:120164362-120164384 AAAGAGAAAAAAGAGAAGGAAGG - Intergenic
960767502 3:121151709-121151731 AGGGAAAAAAAATAAGAGGAAGG - Intronic
960803188 3:121559114-121559136 AGAAGGAGAAAATAGGAGGAGGG - Intergenic
960855385 3:122097467-122097489 AAGAGGCTAAAATGGGAGGAAGG + Intronic
960858847 3:122131031-122131053 AAGGAGGAAGAAGAGGAGGAAGG - Intergenic
961905334 3:130257085-130257107 AACTGGAAAAAGTAGGGGGAAGG - Intergenic
962004088 3:131330906-131330928 GAGGGGAAAAGAGAGAAGGAAGG + Intronic
962047732 3:131778290-131778312 AAGGGTACACGATAGGAGGAGGG - Intronic
962097257 3:132304877-132304899 ATGGGGAAAAAAAAGTAGGGGGG + Intergenic
962237613 3:133720079-133720101 AAGGAGAAAAAATAGGGAAAAGG - Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962486843 3:135851956-135851978 TAGTGGAAAAAATAGGTGGGGGG - Intergenic
962525781 3:136236382-136236404 AAGGGGAAAGAACGGCAGGAGGG - Intergenic
962630378 3:137269668-137269690 AAAGGGAGAAAATAGGGGGTGGG + Intergenic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
962759062 3:138492409-138492431 AAGGGGAAGGAAGAGCAGGAAGG - Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963049805 3:141131257-141131279 AATGGGAAAAAGTAGGGGGAAGG - Intronic
963272842 3:143302573-143302595 AAGAAGGAAAAATAGCAGGAGGG + Intronic
963447131 3:145427099-145427121 AAGGGGAGAAAATAGCTGAATGG + Intergenic
963529855 3:146461526-146461548 ATGGGGAAAACATGGGAGAAAGG + Intronic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
963638402 3:147828138-147828160 AAGGGGAAAAAATGTTAGTAAGG + Intergenic
963803103 3:149696939-149696961 AAGGGGAAAATGTTAGAGGATGG - Intronic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964989521 3:162790491-162790513 AAAGGGAAAATATATAAGGAAGG - Intergenic
965498536 3:169428882-169428904 AAGGGAAAAAAATAAAAGAAAGG + Intronic
965524616 3:169702594-169702616 ATGAGGAGAAATTAGGAGGAAGG - Intergenic
965729518 3:171755919-171755941 AAGAAGAAAACATAGGAAGAGGG - Intronic
966169257 3:177059598-177059620 AGGGGGAAAAAATGGAGGGAGGG + Intronic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966598035 3:181745028-181745050 AAGGGGAAGAGAGAGAAGGAAGG - Intergenic
966627281 3:182031879-182031901 AAAGGGAAAAGAGATGAGGAGGG - Intergenic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
966829762 3:183997513-183997535 ACAGGGAAGACATAGGAGGAAGG - Intronic
967274301 3:187758816-187758838 AGGGGGAAGAAAGAGGAAGAAGG - Intergenic
967439695 3:189492282-189492304 AAGGGGAAAATATATGCGCAGGG + Intergenic
967517905 3:190392267-190392289 AGGGGGAATAAAGAAGAGGAAGG - Intronic
967553343 3:190825736-190825758 AAGGGGAAAAAAGGAAAGGAAGG - Intergenic
967643028 3:191890364-191890386 AAGTGGAAAATATTAGAGGAGGG - Intergenic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
969143882 4:5102943-5102965 AAGGGGCAAAAAGGAGAGGAGGG - Intronic
969495318 4:7523048-7523070 AAGGGGAGAGAAGGGGAGGAAGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970069217 4:12137440-12137462 CTGGGAAAAAAATAGGTGGAAGG + Intergenic
970248460 4:14089314-14089336 AAGAGGAGAAAATATCAGGAAGG - Intergenic
970488196 4:16545200-16545222 GGGGGGAAAAAACAGAAGGAAGG - Intronic
970732623 4:19124905-19124927 AAGTGGGAAAAAAAGAAGGAAGG + Intergenic
970967468 4:21945129-21945151 AAGGACAAAAAATAGTAAGAAGG + Intronic
971591681 4:28476798-28476820 ATGGGGAGAAAAGAAGAGGAAGG - Intergenic
971594330 4:28509593-28509615 AAGGGAAAGAAAGAGAAGGAAGG - Intergenic
971596834 4:28540281-28540303 AAGGGGAAAGAAAGGTAGGAGGG - Intergenic
971632562 4:29012612-29012634 AAGGGGAAATAATAGGATACTGG + Intergenic
971757216 4:30720259-30720281 AAGGGGAAAGGAGAGGAGGGAGG + Intergenic
972028812 4:34425128-34425150 AAGAGGAAAAAAGTGGAGCAGGG + Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973019248 4:45179753-45179775 AAAGGGAAAAAAAAGGATAATGG + Intergenic
973128403 4:46618250-46618272 AAAGTGAAAAAAGAGGAAGAAGG + Intergenic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974062818 4:57051134-57051156 ACGGGAAAAGAATAGTAGGAAGG + Intronic
974073359 4:57146025-57146047 AGGAGGAATAAATTGGAGGAGGG - Intergenic
974142278 4:57902452-57902474 GAGGGGAAAAAAAGGCAGGATGG + Intergenic
974332447 4:60498040-60498062 AAGGGGTAAATATAGTAGTAGGG - Intergenic
974997026 4:69174225-69174247 GAGGGGAAAAAAGATGAGAATGG - Intronic
975436117 4:74353820-74353842 AAGGGGAAAGAAAAGAAAGATGG + Intergenic
975967576 4:79993236-79993258 AAGGGGAGAGAAAAGGAGGGAGG + Intronic
976019313 4:80601586-80601608 AAGGGGAAAAAATACAACAATGG - Intronic
976242543 4:82973913-82973935 AAGTGCCAAAAATAGGAGCAGGG + Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976955583 4:90894664-90894686 AAGAGGAGAAAATGTGAGGAAGG - Intronic
977093738 4:92713335-92713357 AATAGGAAAAAATAAGAGAATGG + Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
977963407 4:103111734-103111756 AAGGGGTAAAAATAGAAGTGAGG - Intronic
978112472 4:104978979-104979001 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
978295068 4:107195472-107195494 AAGGAGAAAATATGGAAGGATGG + Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978593137 4:110348118-110348140 AAGGGGAAAAAAAGGAAAGACGG - Intergenic
978623094 4:110654160-110654182 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
978667588 4:111204146-111204168 AAGAGAAAGAAATAGAAGGAAGG + Intergenic
978776795 4:112513803-112513825 AAAGGGAAAAATCAGGAGGGAGG - Exonic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979556968 4:122058930-122058952 AACAGGATAAAATTGGAGGAAGG + Intergenic
979798002 4:124871266-124871288 ACTGGGAAAAGGTAGGAGGAAGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
979945885 4:126830602-126830624 AAGGGGAGGAAATAGTGGGAAGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
980093668 4:128467729-128467751 AAAGGGAAGAGATGGGAGGAGGG - Intergenic
980198804 4:129626943-129626965 AAGGGGAAGAAATAAGAGAGAGG - Intergenic
980245514 4:130235039-130235061 AAGGGACAAAAATTGAAGGAGGG - Intergenic
980267391 4:130535168-130535190 AAAGGTAAAAAATAGGTGAAGGG - Intergenic
980347269 4:131636747-131636769 AAGGGGAGAGAAGAGGAAGAAGG + Intergenic
980581769 4:134763471-134763493 AAGAGCAAAAAGTGGGAGGAAGG - Intergenic
980682967 4:136187619-136187641 AAGGGGAATAAAGAGTGGGAAGG + Intergenic
980807082 4:137828130-137828152 AAGGGGAAGAAAGGGAAGGAAGG + Intergenic
980807098 4:137828178-137828200 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980807110 4:137828216-137828238 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
981329266 4:143488971-143488993 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
981334836 4:143558690-143558712 GAGCGCAAAAAATAGGAGGCTGG - Intergenic
981617968 4:146662660-146662682 AAGGAGAAAGAAGAGAAGGAAGG - Intergenic
981825612 4:148937484-148937506 GAGTGGAAAAGATAGGCGGATGG - Intergenic
981988147 4:150883055-150883077 AAGTGGAGAAAATTGGAGGGGGG - Intronic
982169574 4:152648030-152648052 AAGAAGAAAAAAGAGAAGGAAGG + Intronic
982321550 4:154082349-154082371 AAAGGGAAAAAAGAGGAGACTGG - Intergenic
982611979 4:157586312-157586334 AAAGGGAGAAGAAAGGAGGAGGG - Intergenic
982995728 4:162342189-162342211 GTGGGGAAATAATTGGAGGATGG + Intergenic
983398639 4:167234652-167234674 AAGAGGAAAAAAACGGAGGTCGG - Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983516159 4:168658724-168658746 AAAAGGATAAAATAGAAGGATGG - Intronic
983530701 4:168807116-168807138 AAGGGGAAAAGATTAGAGGAGGG + Intronic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983658772 4:170110778-170110800 AAGGGGAAAAAACAGGCAGGAGG - Intergenic
983795156 4:171853347-171853369 AAGGGGAAAGAAGGGGAGGAAGG - Intronic
984346046 4:178527458-178527480 CAGCAGAAAAAATAGGAGGTAGG + Intergenic
984825536 4:183920698-183920720 AAGAGGAAGAAATAGCAGCAGGG - Intronic
984946770 4:184974953-184974975 AAGGGGAAAAGAAAGAATGATGG + Intergenic
985192912 4:187396516-187396538 AGAGGGAAAGAATAGGAAGAAGG + Intergenic
985421380 4:189788303-189788325 AAGGGAAAAAAAGAGAGGGAAGG + Intergenic
986029407 5:3881185-3881207 AAGGGGTAAAGACAGGAGGCAGG - Intergenic
986298318 5:6457530-6457552 AAGGGGCAAAATGAAGAGGATGG - Intronic
986913404 5:12585746-12585768 AAGGGGAATAAAGAGTATGAAGG - Intergenic
987015607 5:13815677-13815699 GAAGGGCAAAAAGAGGAGGAAGG + Intronic
987246342 5:16053077-16053099 AAAGGGAAGAAAAAGGAAGAGGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987457955 5:18170057-18170079 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
987891152 5:23880428-23880450 AAGGGGGAAAGGTAGGAGGGAGG + Intergenic
988013319 5:25518958-25518980 AAAGGGAAAAAGTTGGCGGAGGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988166216 5:27593016-27593038 TAGGGGCAAAAATATGAGGAAGG - Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988368495 5:30334764-30334786 AAGGTGAGAAGATAGGAGGGGGG + Intergenic
988413396 5:30915261-30915283 AAGGAGGCTAAATAGGAGGAGGG + Intergenic
988839179 5:35066562-35066584 AAGGGGAAATAAGAAGAGGAAGG - Intronic
988899513 5:35717608-35717630 AAGGGAAAAAAAGAGGAAAACGG + Intronic
989488167 5:42016355-42016377 AAGGAAAAAAAAAAGGAGGGAGG - Intergenic
989600213 5:43193374-43193396 AAGGGGAAAAGAGAGGAGAAAGG - Exonic
990024426 5:51167997-51168019 TGGGGGAAAAAAAAGGAAGAAGG - Intergenic
990248507 5:53888769-53888791 TAGGGGAAAAAAGAGTAGGGAGG + Intronic
990767079 5:59195955-59195977 AAGGGGCAAAAATGGAAGCAGGG + Intronic
990989126 5:61668226-61668248 AAGGGAGAGAAATCGGAGGATGG + Intronic
991037506 5:62142826-62142848 TAGGGGAAAGAATGGGAAGAAGG + Intergenic
991092681 5:62708165-62708187 AAGGGGAAGAGACAGGATGAGGG + Intergenic
991325177 5:65423166-65423188 AAGGGGGAAGGATAGGAGGAGGG + Intronic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
991616336 5:68500915-68500937 AAGGGGAAAAAAAAGTCGAACGG - Intergenic
991974783 5:72175051-72175073 AAGGAGGAAAGATAGAAGGAAGG - Intronic
992212704 5:74496349-74496371 ATGGAGGAAAAATAGGAGGCAGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992637069 5:78735426-78735448 ACAGGGAAATAATAGGAAGAGGG + Intronic
992823884 5:80528287-80528309 AAGGGGGAAAAAAAGAAGGAAGG + Intronic
992873297 5:81027002-81027024 ATGGGGAAAAAATAAGAAGCAGG - Intronic
993032265 5:82718331-82718353 AAGGAGAAAAGAAAGAAGGAGGG + Intergenic
993097720 5:83499556-83499578 AAGAGGAAAAAATAGTATCATGG - Intronic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993505097 5:88699650-88699672 AAAGGGAAAAAAAAAGAGAAAGG - Intergenic
993540046 5:89138124-89138146 AAGGGGGAAGGATGGGAGGAGGG - Intergenic
993808707 5:92445792-92445814 AAGGGAAAAACAGAGGAGGAGGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994067947 5:95564551-95564573 AAGGGGAAGGAATGGGAGGCAGG - Intronic
994141671 5:96348249-96348271 GAAGGGAAGAAATAGGATGATGG + Intergenic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994467354 5:100154780-100154802 AAGTGGCAAAAAGGGGAGGAAGG + Intergenic
994512877 5:100729480-100729502 AAGGGGTATAAATATGAGCAAGG + Intergenic
994562771 5:101397349-101397371 AAGGGGAAAAAATGTTAGCAAGG - Intergenic
994574762 5:101564134-101564156 AAGGGGGAAAAAAAAGAGGGAGG - Intergenic
994591727 5:101782668-101782690 AAAGGTAAGAAACAGGAGGAAGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995432928 5:112101969-112101991 AAGGGGAAAAAATTGGTTTACGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995542963 5:113202209-113202231 AGGGGGAAAAAAAAAAAGGAAGG + Intronic
995651509 5:114374273-114374295 AAGGGGAATAATTTGGATGATGG + Intronic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
996152253 5:120053554-120053576 AAGTTGAAAAAAAAGAAGGAAGG - Intergenic
996376115 5:122809432-122809454 AAGGGGGACAGATGGGAGGATGG + Intronic
996408585 5:123130364-123130386 AAAGAGAGAAAAAAGGAGGAGGG - Intronic
996422421 5:123277502-123277524 TAGGGCAAAAAATTGCAGGAAGG - Intergenic
996696591 5:126403585-126403607 TAGGGGAAAAAAGAGCAGGGGGG + Intronic
997003100 5:129785163-129785185 AAGGGGAGAGAAGAGTAGGAAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997648489 5:135497589-135497611 AAGTGGAAAACAAAGGAGGCAGG + Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
998058742 5:139102631-139102653 GAGGGGAAGGAATGGGAGGAGGG - Intronic
998191849 5:140031964-140031986 AAGGAGAAACATTAGGAGAAAGG + Intronic
998884729 5:146682350-146682372 GATGGGAAAAAAGAGGAGAAAGG + Intronic
998932161 5:147193465-147193487 AAGGGAAAAAAAGAGAGGGAAGG + Intergenic
999643412 5:153694907-153694929 AAGGAGGAAGAATAGGAGGAAGG + Intronic
999712115 5:154328078-154328100 AAGGGGAAAAAAAAAAAGGAGGG + Intronic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999965099 5:156800881-156800903 AAGGGGAAAAGCAAGCAGGAGGG + Intergenic
1000204442 5:159045354-159045376 TAGGGGAGAAAAAAGGAGGGAGG - Intronic
1000266343 5:159641574-159641596 AAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1000839088 5:166194133-166194155 AAAGGAAAAAATTAGGAGGGAGG - Intergenic
1000930337 5:167243738-167243760 GAGGGGAAAATATAGAAGCACGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001289578 5:170447229-170447251 AAGGGGAAGAATTGGGAGGGGGG + Intronic
1001375273 5:171250727-171250749 AAGGGGAAAAAAGACAAAGAAGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002398391 5:178975999-178976021 CAGGGGAGAAAATGTGAGGAAGG - Intergenic
1002692785 5:181061992-181062014 AAGGGGAAAGGAGAGGATGAGGG + Intergenic
1003222396 6:4172674-4172696 ATGGGGAAAAAATAGGGGAATGG - Intergenic
1003465433 6:6376096-6376118 AAGGGGAAAGGGTAGGAGGTGGG + Intergenic
1003551992 6:7108341-7108363 AAAGGGAAAAGAGCGGAGGAAGG - Intronic
1003568344 6:7239399-7239421 GAGAGGAAAAGAGAGGAGGAGGG - Intronic
1005024023 6:21445704-21445726 AAGGGGAAAGAAAGGAAGGAGGG - Intergenic
1005035690 6:21553161-21553183 AAGGGGAACAAATTGGAGGGAGG + Intergenic
1005162704 6:22883210-22883232 AGAGGTAAAGAATAGGAGGAAGG - Intergenic
1005435639 6:25808340-25808362 GAGGGGAGAAAATGGGAGGACGG + Intronic
1005533406 6:26730766-26730788 GAGTGGAAAACATGGGAGGATGG - Intergenic
1005537388 6:26770898-26770920 GAGTGGAAAACATGGGAGGATGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1006227510 6:32552678-32552700 AAGGACAAAAAATAAGAGAAAGG - Intergenic
1006253680 6:32812497-32812519 AAGGGGGAAAAAAAGGCTGATGG + Intergenic
1006822541 6:36909545-36909567 ATGGGGAAAAAATATGAACAAGG - Intronic
1007437111 6:41822226-41822248 ATGTGGAGAAAATGGGAGGAGGG - Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007781711 6:44258128-44258150 AAGGGAAAAGAATAGTGGGAAGG - Intergenic
1007941982 6:45789898-45789920 AAGAGGAGAGAACAGGAGGAAGG + Intergenic
1008023191 6:46603493-46603515 AAGGGGAGAAAAAAGGAAGGAGG - Intronic
1008167721 6:48160064-48160086 AAGAGAAAAAAATAGGATGCAGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008455196 6:51702425-51702447 CAGGGGAAAAGATAGGAGGCAGG + Intronic
1008455699 6:51708221-51708243 ATGAGGAAAAGAGAGGAGGAGGG - Intronic
1008509284 6:52261197-52261219 AAGGGGGATAAAGAGGAGAAAGG - Intergenic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1009008269 6:57813308-57813330 GAGTGGAAAAGATGGGAGGATGG + Intergenic
1009260868 6:61485623-61485645 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009450544 6:63794966-63794988 AAGTAGTAAAAAGAGGAGGAAGG + Intronic
1009593738 6:65708771-65708793 AATGGGGAAAAGGAGGAGGAAGG - Intergenic
1009600785 6:65795026-65795048 AAGGGGAAAATAAAGAAGAAAGG - Intergenic
1009860066 6:69317312-69317334 AAGGAGAAAGGAGAGGAGGAGGG + Intronic
1010383602 6:75252004-75252026 AAGTGGAAGAAATATGGGGAGGG + Intergenic
1010415754 6:75609559-75609581 ATGGGGAAAAAATACCAGGTAGG - Intronic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1010553382 6:77250798-77250820 TAGTGGAAAAAATAGGACCATGG + Intergenic
1010742471 6:79525424-79525446 AAGGGGAATAATTAGGAGAGTGG + Intronic
1010772541 6:79848032-79848054 AAGGGGAAAGAAGAGCAGGAGGG + Intergenic
1011036500 6:82982458-82982480 GAGGAGAAAAGATAGAAGGAAGG - Intronic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011449968 6:87482239-87482261 TGGGGGAAAAAAAAGGAGGGGGG - Intronic
1011695750 6:89911269-89911291 AAGAGGAAAAGAAGGGAGGAAGG - Intergenic
1011701125 6:89955862-89955884 AATGGGAAAAAATAAGAGGGGGG + Intronic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012604886 6:101145493-101145515 AAAGGAAAAAAACAGGAGGATGG - Intergenic
1012620499 6:101339125-101339147 AAGGGGAAGGAATAGTGGGAAGG - Intergenic
1013270555 6:108542009-108542031 AAAGGGAAAAGAGAGAAGGAGGG - Intergenic
1013322992 6:109013256-109013278 AAGGGGCAAAACTAGGGGCAAGG + Intronic
1013529774 6:111008403-111008425 AAGGGAAAAAAAAAAGAGAAAGG - Intronic
1013720505 6:113020955-113020977 AAGGGCAGAAAAAAGGTGGAAGG + Intergenic
1013918556 6:115371097-115371119 TAGGGGAAAAAATAAAAGCAAGG + Intergenic
1014096757 6:117469670-117469692 AAGGGGAAATAAAAGCATGAAGG - Intronic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014536234 6:122616280-122616302 AAGAGGACATAATAGGAGAAGGG + Intronic
1014545737 6:122733326-122733348 AAAGGGAAAACTTAGGAAGATGG - Intergenic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014899885 6:126950053-126950075 AAGGGGAAAGAAAAGGGGAAGGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015607519 6:134973991-134974013 AAGAGGAAATAATAGAAGAATGG - Intronic
1015825492 6:137306760-137306782 AGGGGCAACAGATAGGAGGACGG - Intergenic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1016035136 6:139376186-139376208 AAGGGGGAAAAAGACGAGGGGGG - Intergenic
1016362188 6:143279418-143279440 AAGTGGAAAGATTAGGAGGCTGG - Intronic
1016498396 6:144690150-144690172 AAGGGGCAAAACCAGGAGGGAGG + Intronic
1016679758 6:146815734-146815756 AAAGAAAAAAATTAGGAGGATGG - Intergenic
1017297216 6:152811983-152812005 AAAGAGAAAGAAGAGGAGGAAGG - Intergenic
1017689342 6:156947658-156947680 ATGAAGAAAAAATAGGGGGAGGG - Intronic
1017849727 6:158294704-158294726 AAGAAGAAAAAAGAGGAAGAAGG - Intronic
1018170184 6:161138197-161138219 AAGGGAAAAAAATAAGAGGTTGG - Intronic
1018234523 6:161710966-161710988 AAGGGGAAAAGAGGGTAGGAGGG - Intronic
1018365173 6:163112561-163112583 AAGGAGAAAAATGAGGGGGAAGG - Intronic
1018727897 6:166627512-166627534 AAGGAGTAGAAAGAGGAGGAGGG - Intronic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019841558 7:3451208-3451230 AGGGTGAAAATATAGGAGAAAGG + Intronic
1020080033 7:5282226-5282248 AGGGGGAGAAAAGAGGAGGATGG + Intronic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1020972473 7:14962996-14963018 AAGGGAAACAAATATGAGAACGG - Intronic
1021028173 7:15695319-15695341 CAGGGGGAAAAAGAGGTGGAGGG + Intergenic
1021132588 7:16928973-16928995 AAGGGGAAAAAAAATAAAGATGG - Intergenic
1021352965 7:19617704-19617726 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1021971042 7:25966539-25966561 AAGGAGGAAAGAAAGGAGGAAGG + Intergenic
1022203527 7:28140434-28140456 AAGGTGTCAAAATATGAGGAAGG + Intronic
1022368559 7:29749418-29749440 AAGAAAAAAAAACAGGAGGAAGG - Intergenic
1022386674 7:29905825-29905847 ATGGGGAAAAAAAAAGAGCAAGG - Intronic
1023083976 7:36551547-36551569 AAGGGCAGAAAGTAGGAGGGTGG - Intronic
1023475827 7:40576810-40576832 AAGGTGAAAGCATAGGAGGCAGG - Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023521294 7:41052624-41052646 AAGGCCAATGAATAGGAGGATGG - Intergenic
1023636815 7:42220344-42220366 AAAGAGAAAAGATAGGAAGAGGG + Intronic
1023679055 7:42664857-42664879 AAGGGGGATAAAAAGGAGGCAGG + Intergenic
1023745983 7:43322825-43322847 AAAGGGAAAAAATTGGTGCATGG - Intronic
1023910079 7:44547691-44547713 AAAGAGAAAAGAAAGGAGGAAGG + Intergenic
1024233080 7:47377692-47377714 GAGGGGGAAAAAGAGGAAGAGGG - Intronic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024754113 7:52508022-52508044 ATGAGGAAAAAATAAGAGTAAGG + Intergenic
1024847367 7:53662714-53662736 AAGGGGAAAGGATGAGAGGAGGG - Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024994104 7:55258138-55258160 AAGGGGAAAAAAAAGTTGGCAGG - Intergenic
1025160531 7:56655345-56655367 AAGGAGAGAAAAGAGTAGGAAGG + Intergenic
1025198883 7:56949990-56950012 AGGGGGAGAAAAGAGGAGGATGG - Intergenic
1025673063 7:63626943-63626965 AGGGGGAGAAAAGAGGAGGATGG + Intergenic
1025726200 7:64063849-64063871 AAGGAGAGAAAAGAGTAGGAAGG - Intronic
1025754954 7:64329974-64329996 AAAGAGAAAAAAGAGTAGGAAGG - Intronic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026300152 7:69090634-69090656 AAGGGAAAGAAAGAGAAGGAAGG + Intergenic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026900290 7:74033335-74033357 GAGGGGGAGAAAGAGGAGGAAGG + Intronic
1026915342 7:74116695-74116717 AAAGAAAAAAAAAAGGAGGAAGG - Intronic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027755818 7:82210792-82210814 AAAGGGAAACAACAGGAGAATGG - Intronic
1027974869 7:85139089-85139111 TAGAGGAAAAAATAGGTGCAAGG + Intronic
1028212696 7:88094486-88094508 AAGGGATGAAAGTAGGAGGATGG + Intronic
1028219972 7:88185723-88185745 AAGGTAAAAAAATTGGAGGGAGG - Intronic
1028302421 7:89217184-89217206 AAGAGGAAAATATAGAAGCAGGG + Intronic
1028594572 7:92534084-92534106 GTGGGGAGAAAATGGGAGGAAGG + Intronic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028727812 7:94109221-94109243 AAGGAGGAAGAAGAGGAGGAGGG + Intergenic
1028988108 7:97023575-97023597 AAGCGGACGAAAAAGGAGGACGG + Intronic
1029045527 7:97623840-97623862 AAGGGGTGAAAAAAGAAGGAAGG + Intergenic
1029249162 7:99223720-99223742 AAGGGGAAAAAAAGGAAGGAAGG + Intergenic
1029408643 7:100393792-100393814 CCTGGCAAAAAATAGGAGGAAGG + Intronic
1029546342 7:101212379-101212401 GAGGGGAAGACATAGGGGGATGG + Intronic
1029574691 7:101395725-101395747 AGAGGGGAAAAATAGGGGGAAGG + Intronic
1029794044 7:102875326-102875348 AAGGGGAGAGAAGAGGTGGAGGG + Intronic
1030014950 7:105209613-105209635 AAGGGGAAAGAAAAGGGGAAGGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030180668 7:106705540-106705562 AAAGGGACAAAACAGGATGATGG - Intergenic
1030332519 7:108286475-108286497 AAGCGGAAAAAAAAGGAAGGAGG + Intronic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1030529249 7:110692342-110692364 AGGGGGAATAAATGGGAGGAGGG + Intronic
1030740184 7:113100287-113100309 AAGGAGAAAAAAATGAAGGAAGG - Intergenic
1031150719 7:118050780-118050802 AAGGAGAAAAAATAGGGAGTGGG - Intergenic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031682881 7:124695853-124695875 AAGGGAAAGAAAAAGAAGGAAGG + Intergenic
1031840972 7:126738830-126738852 AAGAAGGAAAAAAAGGAGGAGGG + Intronic
1031926751 7:127646254-127646276 AAAGAAAAAAAAAAGGAGGAGGG + Intergenic
1032337543 7:131040102-131040124 AAGGGGAAAAAAAAGTATGTGGG + Intergenic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032690402 7:134280737-134280759 AATGGGAAAATTTAAGAGGAAGG - Intergenic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1032941053 7:136792434-136792456 AAGAGGAAAAAAAGAGAGGAGGG + Intergenic
1033006040 7:137564276-137564298 AAGAAGAAAATATAGGAGAATGG + Intronic
1033075733 7:138248693-138248715 AAGAGAAAAAAAGAAGAGGAGGG + Intergenic
1033137384 7:138796696-138796718 GATGGGAATAAAAAGGAGGATGG - Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033318492 7:140318135-140318157 GAGGAGAAAAAATCGGGGGATGG + Intronic
1034634898 7:152559487-152559509 AAGGGAATAAAAAAGGAAGAGGG - Intergenic
1034687954 7:152990121-152990143 GAGGGGGAAAAAAAAGAGGAAGG - Intergenic
1035289005 7:157825241-157825263 AAGGGGGAAGAAGAGGAGCAGGG - Intronic
1035346552 7:158203647-158203669 AAGGGCAAAAAATAGAGGGCTGG - Intronic
1035791816 8:2313186-2313208 AAGGGGGAAAAAAAGAAGGCTGG - Intergenic
1035800989 8:2408519-2408541 AAGGGGGAAAAAAAGAAGGCTGG + Intergenic
1036207787 8:6818013-6818035 AAAGGGAGAAAAAGGGAGGAAGG - Intronic
1036524574 8:9522691-9522713 AATGGGAAAAAAAAGGTGAATGG + Intergenic
1036930620 8:12952014-12952036 AAGAGGAAAAAATAGACGGAGGG - Intronic
1037151248 8:15637828-15637850 GAGAGGAAGAAATAGGAGGGAGG - Intronic
1038038334 8:23704712-23704734 AAGAGGAAAAATTCTGAGGAGGG + Intronic
1038398521 8:27265337-27265359 AAGGGGAGAAAAGAGGAGTTGGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038939321 8:32286379-32286401 AATGGGAAAACATAGGAGTGAGG - Intronic
1038941442 8:32310110-32310132 GAATGGAAAGAATAGGAGGAGGG + Intronic
1038956693 8:32475494-32475516 AATCAGAATAAATAGGAGGAGGG - Intronic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039212568 8:35234531-35234553 AAAGGCAAAAAAAAGGGGGATGG - Intergenic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1039714450 8:40092581-40092603 AAGAGGAAAAAGTAGGTAGAAGG + Intergenic
1039757627 8:40540310-40540332 AAAGGGAAAAAAGGGAAGGAGGG - Intronic
1040039998 8:42906147-42906169 AAGGGAAAAAAAGAGGGGGGGGG - Intronic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1041207610 8:55513957-55513979 CAGATGAAAAAATAGGAGGTGGG - Intronic
1041451252 8:58008884-58008906 AAGAAGAAAAACTAGGATGAGGG - Intronic
1041540348 8:58977727-58977749 GAGGGGGAAAAATAGGAGAGCGG + Intronic
1041775167 8:61515060-61515082 AGAGAGAAAAAATAGGAGGTAGG + Intronic
1041870942 8:62633808-62633830 AGGGGGAAAGAATATGAAGAAGG + Intronic
1042034897 8:64522068-64522090 AAAGGGAAAAGATAAGAGGAAGG - Intergenic
1042102918 8:65293728-65293750 AATAGGAAAAAATAGGTGGGTGG + Intergenic
1042588537 8:70370743-70370765 AAGGAAAAAAAAGAGAAGGAAGG + Intronic
1043045605 8:75319838-75319860 AAGAAGAAAAAACAGGAGAATGG - Intergenic
1043291642 8:78609212-78609234 AAGGGGGAAAAATTGTAGAAAGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043528519 8:81123289-81123311 AAGGGGAAATGGTAGCAGGAAGG + Intergenic
1043727869 8:83633957-83633979 AAGAAAAAAAAAGAGGAGGAAGG - Intergenic
1043778982 8:84307688-84307710 ATGGGGAAGAAAGAGGAGCAAGG + Intronic
1043918395 8:85951679-85951701 AAAAGGAAAAAATATGAGCAAGG + Intergenic
1044070826 8:87757343-87757365 AAGGGGAAAAAAAGGAGGGAAGG + Intergenic
1044410888 8:91881414-91881436 AAAGGGTAAAAATAGAGGGAGGG + Intergenic
1044636178 8:94326792-94326814 GAAGGGAAAAAATATCAGGAGGG + Intergenic
1044743004 8:95346849-95346871 AAGGGGAAAGGAAAGGAGAAAGG - Intergenic
1045015041 8:97994166-97994188 AGAGGGAAAGAAGAGGAGGAGGG + Intronic
1045042183 8:98236514-98236536 AAGGGGCAGAAAGAGCAGGAAGG + Intronic
1045084107 8:98662031-98662053 AGGGACAAAAAATAGGAGTAAGG - Intronic
1045399673 8:101800899-101800921 AGGGGGAAAAAAGGGGAGGGGGG + Intronic
1045488280 8:102651275-102651297 AAGGGGAAAACCCAGGAGCAGGG + Exonic
1045866437 8:106871212-106871234 AAGGGGAACATAGAGAAGGAAGG - Intergenic
1045932171 8:107639846-107639868 AAGGGTAAAAAATAGCTAGAAGG + Intergenic
1046063243 8:109164273-109164295 AAGGGGAAGAAAGGGGAGGAGGG + Intergenic
1046114097 8:109764952-109764974 AAGGGGAGGAAAGAGCAGGAAGG - Intergenic
1046332272 8:112734225-112734247 AAAGAGAAAGAAGAGGAGGAAGG + Intronic
1046476362 8:114749868-114749890 AAGAAAAAAAAATAGGAGGAGGG - Intergenic
1046515854 8:115259620-115259642 AAGGGTAAAAACTAAGTGGATGG - Intergenic
1046546567 8:115658515-115658537 AATGGGAAAAATTAAAAGGAGGG + Intronic
1046551947 8:115729140-115729162 AAGGGAAAGAAAGAGAAGGAAGG + Intronic
1046754765 8:117962017-117962039 CAGGGGAAAAAATACCAGCAAGG + Intronic
1046756735 8:117980269-117980291 AAGGGGAAAAGAGAGGGGGAAGG - Intronic
1047136764 8:122088001-122088023 AGGGGTAAAATTTAGGAGGAGGG + Intergenic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047331444 8:123892262-123892284 AATGGGAAAAAAGAGGATGGAGG + Intronic
1047662891 8:127057627-127057649 AAGGGGAAGTATTAGGAAGAGGG + Intergenic
1047832968 8:128656382-128656404 AAGAGGTAAGAATAAGAGGATGG + Intergenic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048524976 8:135194221-135194243 AAGGGGCAAAAATAGAAGCAAGG - Intergenic
1048710132 8:137200805-137200827 ATGGGGAGAAAATGGCAGGAAGG - Intergenic
1048729546 8:137423042-137423064 TAGGGTAAAAGATAAGAGGATGG + Intergenic
1049730820 8:144177430-144177452 GAGGAGAAACAATAGTAGGAAGG - Intronic
1050085293 9:1959051-1959073 AGTGGGAAAAAATAGAGGGATGG + Intergenic
1050612752 9:7370340-7370362 AAGGGAAAAACAAAGTAGGAAGG + Intergenic
1050643107 9:7690297-7690319 AAGGAGAAAAAACAGGAAGCAGG + Intergenic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1051087811 9:13371224-13371246 AAGGGGAGAAAATGAGAGGATGG - Intergenic
1051164759 9:14249718-14249740 AAAGGGAAAAGAAATGAGGAAGG + Intronic
1051884207 9:21873028-21873050 AAGAGGAGAGAATAGGAAGAGGG - Intronic
1052284107 9:26765113-26765135 TAGGGGAAAAAACTGGATGAGGG - Intergenic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1052754176 9:32524009-32524031 AAGAGGAAAAATTAGCTGGAAGG - Intronic
1053039795 9:34860560-34860582 GAGAGAAAAAAATAGAAGGAAGG - Intergenic
1053314735 9:37041718-37041740 AAAGGGAAGAAATAAGAGAAAGG + Intergenic
1053754001 9:41284745-41284767 ATGTGGCAAAAACAGGAGGAAGG - Intergenic
1054259519 9:62849107-62849129 ATGTGGCAAAAACAGGAGGAAGG - Intergenic
1054332254 9:63770930-63770952 ATGTGGCAAAAACAGGAGGAAGG + Intergenic
1054363720 9:64207679-64207701 CAGGATAAAAAATAGAAGGAAGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1054991429 9:71331751-71331773 AAGGGGGAGAAAAAGGAGAAGGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1055826689 9:80335003-80335025 AGAAGAAAAAAATAGGAGGACGG + Intergenic
1055952071 9:81738611-81738633 AAGGAGGGAAAATAGGAGGGAGG + Intergenic
1055989510 9:82090580-82090602 TAGAGGAAAAAACAGGAAGAAGG - Intergenic
1056073999 9:83019913-83019935 AAGGGGCAAAGAAAGGAGGAAGG + Intronic
1056220521 9:84446910-84446932 AAGGGGATAAAAAAGAATGAAGG + Intergenic
1056263858 9:84876645-84876667 TATGGAAAAAAATGGGAGGATGG - Intronic
1056315117 9:85380761-85380783 AAGAGGCAAAAGTAGGAGAAAGG - Intergenic
1057422293 9:94922080-94922102 AAGGGGAAAAAATGAAAGGGTGG + Intronic
1058330013 9:103748923-103748945 AAGGGGAAAAAAGAAGTGGAAGG + Intergenic
1058825995 9:108776387-108776409 AAAAGAAAAAAATGGGAGGAAGG + Intergenic
1058850765 9:109010125-109010147 GAGGCTAAAAAATGGGAGGATGG - Intronic
1058985860 9:110207852-110207874 AAGGGGGAAAGACTGGAGGAAGG + Exonic
1059099799 9:111459203-111459225 AAGGGGAAAAAAAAAGAAAAAGG - Intronic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059773326 9:117448582-117448604 AAAGGGGAAAAAGAGGAGCAGGG + Intergenic
1059837019 9:118166690-118166712 GAGGGGAATAATCAGGAGGAAGG - Intergenic
1060017763 9:120101705-120101727 ATTGGGAAAAAAGAGTAGGATGG - Intergenic
1060476377 9:123989861-123989883 AAGAGGAAAAAAAAGAAGGAAGG + Intergenic
1060844316 9:126823242-126823264 AAGTGGATAAAATTGAAGGAAGG - Intronic
1061245001 9:129397087-129397109 CAGAGGAATAAATAGGAGGATGG + Intergenic
1061630883 9:131871476-131871498 AAGGGGAAAAGTTAAGAAGATGG + Intronic
1061711079 9:132488484-132488506 AAGGGGAAAAAAAAGTAGATTGG + Intronic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1203446734 Un_GL000219v1:63742-63764 AAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1185603709 X:1355285-1355307 AGGGGGAGGAAAAAGGAGGAGGG + Intronic
1185714484 X:2330219-2330241 AAGGGAAAAAAAAAGTAGAAGGG + Intronic
1185766832 X:2732479-2732501 GAGGGGGAAAGAAAGGAGGAGGG - Intronic
1185827696 X:3268010-3268032 TTGGGAAAAAAATATGAGGATGG - Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186082492 X:5948599-5948621 AAGGGAAGAAAATTGGAGGCTGG - Intronic
1186124856 X:6402134-6402156 AAGTAGAAAAAATAGGGGCAAGG + Intergenic
1186135649 X:6517615-6517637 AAGAGGAGAAAATAGAATGAGGG - Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187186286 X:16989611-16989633 AAGTGGAAAAAATACAAGAAGGG + Intronic
1187261547 X:17689197-17689219 GAAGGGAAAAAAGATGAGGAGGG - Intronic
1187261551 X:17689215-17689237 AAAGGAAAAAAAGATGAGGAAGG - Intronic
1187612934 X:20961715-20961737 AAGGGGAGAGAATAGTTGGAAGG + Intergenic
1187618646 X:21026742-21026764 AAGGGGAAGTAAGAGTAGGAGGG - Intergenic
1187781510 X:22831827-22831849 AGGGGGAAGAAAAAGGAAGATGG - Intergenic
1187783543 X:22857351-22857373 AAGGGGAGAAAAGAGGGGGAGGG - Intergenic
1188171078 X:26927281-26927303 AAGTGGGAAAAATAATAGGAGGG - Intergenic
1188265465 X:28067949-28067971 AAGGGGCAGAAATAGGACAATGG - Intergenic
1188400162 X:29734733-29734755 AAGGGGGAAAAAAAGGAGAGGGG - Intronic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188444730 X:30244527-30244549 AAGGGGATAAAAAAGAAGGTGGG + Intronic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188472261 X:30553942-30553964 AAGAGGAAAAAAGAAGAGGAAGG + Intergenic
1188550745 X:31361990-31362012 ATGGTTAAAAGATAGGAGGATGG - Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188693089 X:33154631-33154653 AAGGGGAAAAATTAGGGTCAGGG - Intronic
1189136649 X:38557431-38557453 AGGGGGTAACAGTAGGAGGAGGG + Intronic
1189405794 X:40721414-40721436 AAGGGGAGAGAAAAGCAGGAAGG + Intronic
1189609724 X:42719191-42719213 AAGAGGAAAAAGTTAGAGGATGG - Intergenic
1189765314 X:44366275-44366297 AAAGAGAAAAAATGGAAGGAAGG + Intergenic
1189854360 X:45209135-45209157 AAGGGGAAGAAAGAGTAGGAAGG - Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190059313 X:47200833-47200855 AAGGGGAAAAAATGGAGGGCTGG - Intronic
1190187877 X:48251758-48251780 AATGGGAGAAAATGGAAGGAAGG - Intronic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191112894 X:56821655-56821677 AAGGGGAAAAAATAATAGAGTGG + Intergenic
1191149406 X:57204787-57204809 AAGGGGAGAAAAAAGGACTATGG - Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1192028794 X:67486759-67486781 GAGGGTAAGAAATAAGAGGAGGG + Intergenic
1192073223 X:67962673-67962695 AAGGGGAGAAAAGAGTAGGAAGG + Intergenic
1192135116 X:68589587-68589609 AAGGGGAAGAAAGAGCAGGAAGG + Intergenic
1192410364 X:70928353-70928375 GATGGGAAAAAATGGGAGGCTGG - Intronic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1193091885 X:77502369-77502391 AGGGGGAAAAAATCGCAGGCAGG + Intergenic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1193215652 X:78860898-78860920 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1193292530 X:79792376-79792398 AAGAGGAAAAAGTGGGAGGATGG - Intergenic
1193381471 X:80820898-80820920 AAGGGGAAAAAAAAGAGAGAAGG + Intergenic
1193521200 X:82530989-82531011 AATAGGAAAAAATAGAAAGAAGG - Intergenic
1193815790 X:86102930-86102952 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
1193894897 X:87100889-87100911 AAGGGGAAGGAAGAGAAGGAAGG + Intergenic
1193911927 X:87316768-87316790 AAGGGGAGGAAAGAGTAGGAAGG - Intergenic
1194008642 X:88530750-88530772 CAGGGGAAAAAAATGGAGGCGGG - Intergenic
1194026114 X:88752985-88753007 ATGGGGCTAAAATAGGAGGAAGG - Intronic
1194257454 X:91652407-91652429 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194573244 X:95578669-95578691 TAGGGGAAAAAATAAAATGATGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194841917 X:98753732-98753754 AAGGTGAAAGAAAAGCAGGAAGG - Intergenic
1194909342 X:99620589-99620611 AAGGGGAAAATACAGCAGAATGG + Intergenic
1194928873 X:99862454-99862476 AAGGGGAAAGAAAAATAGGAAGG + Intergenic
1195014848 X:100768202-100768224 GAGGGGGAAAAAAAAGAGGAAGG - Intergenic
1195030112 X:100918821-100918843 AATAGGAAGAAAGAGGAGGAGGG - Intronic
1195155881 X:102124741-102124763 AAGGGGAGGAAATAATAGGACGG + Intergenic
1195252893 X:103065242-103065264 TTGGGGAAGAAATAGAAGGAAGG - Intergenic
1195319988 X:103713908-103713930 AAAGGGAAAGAATTGTAGGAAGG - Exonic
1195643959 X:107207594-107207616 AAAGGAAAAAAATAGGACTAGGG + Intronic
1195661510 X:107383699-107383721 AGGGGGAAAAAATAGGACTAGGG + Intergenic
1195863517 X:109406348-109406370 AAGGGTGAAAACTAGGAGGTAGG + Intronic
1196207824 X:112961148-112961170 AAAGGTAAAAAATAGGTAGATGG + Intergenic
1196362446 X:114879601-114879623 CAGGGGAAAGGATAGGAGGCGGG - Intronic
1196370574 X:114975128-114975150 AAGGAGGAAGAAGAGGAGGAAGG + Intergenic
1196485540 X:116203085-116203107 AAGGGGAGAAAAGAGTAGGAAGG - Intergenic
1196642102 X:118074033-118074055 AAGCAGAAAAAATAGGACAAGGG - Intronic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196931401 X:120685153-120685175 AAGGTCAAAAAACAGGAGAATGG - Intergenic
1196980536 X:121209008-121209030 AAGGGGAGAAAAGAGTGGGAAGG - Intergenic
1197307726 X:124863540-124863562 AAGGGGAAAGAAGAGTGGGAAGG + Intronic
1197339873 X:125254152-125254174 AAAGGAAAGAAAGAGGAGGAAGG - Intergenic
1197453858 X:126652520-126652542 AATGGGAAAAGGTAGGAGAAAGG - Intergenic
1197520325 X:127489809-127489831 AAGGGGAGGAAATAGTGGGAAGG - Intergenic
1197696540 X:129555957-129555979 GAGGGGAAAAAAGAGAGGGAAGG - Intronic
1197727481 X:129785997-129786019 AAGAGGAAAGAATAGTGGGAGGG + Intronic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197858731 X:130947302-130947324 AAGGGGAAAAAATCTTAGCAGGG + Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198204220 X:134451266-134451288 AAGGGGAAAAACTAGAAGGAAGG + Intergenic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198301579 X:135338926-135338948 AAGGAGGAAGAATAGCAGGAGGG - Intronic
1198848401 X:140938526-140938548 AGGGGAAAAAAATTGGGGGATGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199022884 X:142903195-142903217 AAATGGGAAAAATAGAAGGAGGG - Intergenic
1199059713 X:143340553-143340575 AAAGAGAAAGAAGAGGAGGAGGG + Intergenic
1199277689 X:145964996-145965018 AAGGGGAGAGAAGAGTAGGAAGG + Intergenic
1199295951 X:146158675-146158697 ATGGAGAAAAAATGGTAGGAAGG + Intergenic
1199326737 X:146507442-146507464 AAGGGGAGAGGGTAGGAGGATGG + Intergenic
1199749179 X:150798327-150798349 AAAGGGAAAGGAAAGGAGGAAGG + Intronic
1200150419 X:153948752-153948774 AATGGGAAAGAAGAGGGGGAGGG + Exonic
1200576112 Y:4891353-4891375 AAGGGGAGAAAAGAGCAGGAAGG - Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201907436 Y:19100203-19100225 TAGGGGGAATAAGAGGAGGAGGG - Intergenic