ID: 1172958764

View in Genome Browser
Species Human (GRCh38)
Location 20:38782179-38782201
Sequence CAGGGTGTAAAGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172958756_1172958764 27 Left 1172958756 20:38782129-38782151 CCAACAGGAAGCAGATGGGATAC No data
Right 1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG No data
1172958755_1172958764 28 Left 1172958755 20:38782128-38782150 CCCAACAGGAAGCAGATGGGATA No data
Right 1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172958764 Original CRISPR CAGGGTGTAAAGATGGTGCA GGG Intergenic
No off target data available for this crispr