ID: 1172962306

View in Genome Browser
Species Human (GRCh38)
Location 20:38807337-38807359
Sequence TCCCTCATCTCCCCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 1, 2: 8, 3: 57, 4: 504}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172962306_1172962310 -1 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962310 20:38807359-38807381 AGAGGCTGGGTGCAGCAGAGCGG 0: 1
1: 0
2: 3
3: 84
4: 605
1172962306_1172962313 18 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962313 20:38807378-38807400 GCGGGAGGATGAACACTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 76
1172962306_1172962312 3 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962312 20:38807363-38807385 GCTGGGTGCAGCAGAGCGGGAGG No data
1172962306_1172962311 0 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962311 20:38807360-38807382 GAGGCTGGGTGCAGCAGAGCGGG 0: 1
1: 1
2: 4
3: 64
4: 630
1172962306_1172962314 28 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172962306 Original CRISPR TCCCTCATCTCCCCACAGCC TGG (reversed) Intronic
900075489 1:813227-813249 GCCCTTAACTCCCCACACCCAGG + Intergenic
900137087 1:1122231-1122253 ACCCTCGTCTCCCCAGTGCCAGG + Intergenic
900179877 1:1306390-1306412 GCCCACACCTCCCCACAGCCCGG + Intronic
900423412 1:2565340-2565362 CCCCCCACCTCCCCATAGCCGGG - Intronic
900479126 1:2889743-2889765 GGCCTCAGCTCCCCACAGCTCGG - Intergenic
900831370 1:4968040-4968062 TCTCTCATCTACCTACAACCTGG - Intergenic
901031464 1:6309356-6309378 TCCCTCCTCTCCCCATATCTTGG - Intronic
901132930 1:6973875-6973897 TGCCCCACCTTCCCACAGCCGGG + Intronic
901205108 1:7490141-7490163 TAGCTCTTCTCCCCACATCCAGG + Intronic
901599443 1:10411410-10411432 TCCCTCATCTCCCACCTGTCAGG - Exonic
901816122 1:11794500-11794522 TCCTTCAGCTCCCCAAAGGCAGG + Exonic
902449798 1:16489855-16489877 TCCCTCATCTCCGACCATCCTGG + Intergenic
902504639 1:16931205-16931227 TCCCTCATCTCCGACCATCCTGG - Intronic
902664149 1:17925852-17925874 TCCGTCTTCTCCCCACAGAGGGG + Intergenic
902722756 1:18315029-18315051 TCCCTGCTCTCCCCTCTGCCTGG - Intronic
902850478 1:19151855-19151877 TGCCTTGTCTCCCTACAGCCCGG - Exonic
903806731 1:26010950-26010972 GCCCTCATCACCCCAGAGCCAGG - Intergenic
903859331 1:26355423-26355445 CTCCTCTTATCCCCACAGCCAGG - Intergenic
903931471 1:26864700-26864722 CCACTCACCTCCCCTCAGCCCGG - Intergenic
904535888 1:31199091-31199113 TCCCTCATCTTTCCCCAGACAGG - Intronic
904563799 1:31415210-31415232 TCCCTCCCTTCCCCACATCCTGG + Intronic
905271831 1:36792449-36792471 ACCATCATCCCACCACAGCCCGG + Intergenic
905444398 1:38016199-38016221 TCCCTCCCCTCCCCACAACTGGG - Intronic
905447094 1:38034575-38034597 TCCCCCTGCTCACCACAGCCAGG + Intergenic
905802383 1:40853251-40853273 TCCCTCATCTCTCTATAACCTGG + Intergenic
906079087 1:43071787-43071809 TCCCTCATCTAGCCGCAGCTTGG - Intergenic
908268701 1:62402555-62402577 GCCCTCCTCTCCCCACAGCTGGG - Intergenic
909037721 1:70613280-70613302 TCCTTCATCTCCCCAAAGCTGGG - Intergenic
909158285 1:72110052-72110074 TCCCTCATGTCTCCCCAGCCAGG - Intronic
909243179 1:73240508-73240530 TCCCCCCTCTCCCCACCCCCTGG - Intergenic
912710149 1:111944229-111944251 TCTTTCCTCTCCCCTCAGCCGGG - Intronic
913049060 1:115099682-115099704 TCACTCATGTCCCCACAAGCAGG - Intergenic
915039218 1:152953815-152953837 TCCCCCTGCTCCCCACAACCTGG - Intergenic
915460926 1:156070246-156070268 GCCCTCTTCTCCCCAGGGCCAGG - Exonic
915899566 1:159836654-159836676 TCCCTCTTCTCCCCAGTTCCTGG + Exonic
915921209 1:159977078-159977100 TTCCTAATCTCACCACAGCCTGG + Intergenic
916727048 1:167532834-167532856 TCCCTCACCTCCCCATAGGAGGG - Intronic
917154745 1:171984393-171984415 TCCCTCCCCTCCACACCGCCCGG + Intronic
917662300 1:177189044-177189066 TCCCTCATCTTCCTGTAGCCTGG - Intronic
918126920 1:181592366-181592388 TGCTGCATCTCCCGACAGCCTGG - Intronic
919468892 1:197954442-197954464 TTCCTCTCCTCCCCATAGCCTGG - Intergenic
919861063 1:201739857-201739879 TCCCTTTTCTCCCCACCACCAGG - Intronic
920096909 1:203492308-203492330 TCCATCTTCTCTCCACAGCCTGG - Intergenic
920455842 1:206100491-206100513 ACCCTCAGGTCCCCACAGGCAGG - Intronic
920658465 1:207894383-207894405 TCCCTGCTCTCCCCAGACCCTGG - Intronic
921606340 1:217159997-217160019 TCCCTCCTCTCCCCACATGGAGG - Intergenic
921648082 1:217643427-217643449 TCCCTCTACACCCCAAAGCCAGG + Intronic
922271333 1:224038101-224038123 GCCCTTAACTCCCCACACCCAGG + Intergenic
922400663 1:225250834-225250856 ACCCTAATCACCCCAAAGCCAGG - Intronic
922966676 1:229696564-229696586 GCCCTCATCACCCCAGGGCCAGG + Intergenic
922969505 1:229724104-229724126 TCCCTCCTCCCCCCACACCATGG - Intergenic
923011176 1:230088907-230088929 TTCCTCATCTCCCCAGTCCCTGG + Intronic
923339537 1:232995881-232995903 CCCCTCCTCTCCCCCCACCCAGG + Intronic
924289481 1:242523890-242523912 GCCCTCCCCTCCCCGCAGCCCGG + Intronic
924621249 1:245663076-245663098 GCCCTGATCTCCCCAAAGTCTGG + Intronic
1062999375 10:1900167-1900189 TTCCCCATCTCCCCCCAGCCTGG - Intergenic
1063083436 10:2790479-2790501 GCCATCATCTGCACACAGCCAGG - Intergenic
1063199728 10:3776286-3776308 TCCCTACTGTGCCCACAGCCGGG + Exonic
1064764162 10:18653890-18653912 TCCCTGAGTTCCCCACACCCTGG - Intronic
1066253003 10:33652377-33652399 TCCCTCCTCTCCCCAGGCCCTGG + Intergenic
1066431881 10:35359781-35359803 TTCCTCATCCCCCCAGATCCTGG + Intronic
1067566938 10:47346297-47346319 TCCTACATCCCCCCACGGCCTGG + Intergenic
1067968325 10:50940354-50940376 ACCATCATATCCCCAGAGCCTGG - Intergenic
1069720136 10:70544569-70544591 GCCCTCCTCACCCCACATCCAGG - Intronic
1069794325 10:71042635-71042657 TGCCTCTTCTCCACACAGCTGGG + Intergenic
1069995715 10:72340956-72340978 TCCCCACCCTCCCCACAGCCAGG - Intronic
1069999948 10:72368829-72368851 TCCCTCATCTCCCCTTAACTTGG - Intronic
1070651832 10:78243082-78243104 TCCCTAAGCTCCACACAGCATGG - Intergenic
1070783589 10:79150778-79150800 TCTCTCATCTCCCAGAAGCCGGG + Intronic
1072027462 10:91475913-91475935 TCCCTCAGGTCCCCACCTCCAGG - Intronic
1073119242 10:101111440-101111462 TCCCCCATCTCCCTCCAGGCTGG - Intronic
1073458815 10:103653823-103653845 ACCCTCCTCCCCACACAGCCCGG + Intronic
1073516375 10:104079084-104079106 TCCCACAACTCCCCACATTCAGG - Intronic
1073632172 10:105159996-105160018 GCCTTCATCTCTCCTCAGCCTGG - Intronic
1074184084 10:111086215-111086237 GTCCTCATCTCCCCTCACCCGGG - Intergenic
1074844458 10:117384957-117384979 ACTCCCATCTTCCCACAGCCAGG + Intergenic
1075394744 10:122119135-122119157 TCCCTTCTCTCCCCAGACCCTGG + Intronic
1076163506 10:128263952-128263974 TAGCCCATCTTCCCACAGCCGGG - Intergenic
1076323464 10:129601488-129601510 TTACTCATCTCCACACTGCCAGG - Intronic
1076796692 10:132801800-132801822 TCGTTCCTCTCCCCACCGCCTGG + Intergenic
1077726009 11:4675701-4675723 ACCCTCCACTCCCCACAACCAGG + Intergenic
1077788123 11:5407278-5407300 TCACTCATCACCACACAGGCAGG - Intronic
1078056923 11:8016665-8016687 GCCTTCAAGTCCCCACAGCCAGG - Intergenic
1078507595 11:11964434-11964456 TTGCACATCTACCCACAGCCTGG + Exonic
1079558398 11:21791012-21791034 TCCCCCAGCTCCCCACCCCCTGG + Intergenic
1080919264 11:36692570-36692592 TCCCACAGTTCCCCATAGCCTGG + Intergenic
1081580087 11:44346124-44346146 GGCCTCATCTCCCCACCTCCTGG + Intergenic
1083000554 11:59287296-59287318 TCTCTCATCTCCAAACAGCATGG - Intergenic
1083329016 11:61888519-61888541 TCCCTCAAGGCCCCACAGCCTGG - Intronic
1083422984 11:62566405-62566427 TCCACTATCTCCGCACAGCCGGG + Intronic
1083609731 11:63999170-63999192 ACCCCCATCTCGCCACCGCCAGG + Intronic
1083994856 11:66266855-66266877 TGCCCCCTCTGCCCACAGCCTGG + Exonic
1084205167 11:67586958-67586980 TCCCTCATTTCCCTCCATCCTGG - Intergenic
1085283720 11:75346713-75346735 TCCCTCTTCTCTCCATACCCAGG + Intronic
1085477807 11:76798885-76798907 TCCCTCTCCTCCACACCGCCCGG - Intergenic
1086582933 11:88420394-88420416 TTTCTCGTCTCTCCACAGCCTGG - Intergenic
1088813325 11:113406007-113406029 TGCCTCCTCTACCCAGAGCCTGG + Intergenic
1088831924 11:113544156-113544178 ACCCTCATCACCCCAGGGCCAGG - Intergenic
1089144787 11:116318320-116318342 TCCCTCCTTGCACCACAGCCTGG - Intergenic
1089559866 11:119338404-119338426 TCCCTCACCCCCCCATAGTCAGG + Intergenic
1090232392 11:125117704-125117726 TCCCACATCTCCCAAAATCCAGG - Intergenic
1090812797 11:130261828-130261850 TAGCTCCTCTTCCCACAGCCAGG - Exonic
1090944966 11:131421392-131421414 TGCCTCCTCTCCCCCCAGGCAGG - Intronic
1091032305 11:132201586-132201608 TCCATCCTCTCCTCAGAGCCAGG - Intronic
1091400782 12:179378-179400 TCTCTCCTCTCTCCCCAGCCAGG - Intergenic
1091603986 12:1935038-1935060 GCCCTCTGCTCCCCACTGCCCGG - Intergenic
1092586252 12:9904273-9904295 TCTCCCAACACCCCACAGCCTGG - Intronic
1092728124 12:11504416-11504438 TCCCTGTCCTCCCCACAGCCTGG - Intergenic
1094748344 12:33374135-33374157 TCCCTCATCGCCCGATTGCCTGG + Intergenic
1094820207 12:34218841-34218863 TTCCTCCTCTCTCCGCAGCCCGG - Intergenic
1095769551 12:45937880-45937902 CCCTTCCTCTACCCACAGCCAGG + Intronic
1096789219 12:54034690-54034712 TGCCCCATCTCCCCTCAGCTCGG + Exonic
1097796366 12:63866824-63866846 TCCCTTATCTCCCCAGAGACTGG - Intronic
1097817292 12:64089197-64089219 TCCCTAATCACCCCAAGGCCAGG + Intronic
1099356437 12:81641587-81641609 TCCTTCATCCCCCAACAGGCTGG - Intronic
1099452359 12:82822900-82822922 CTCCTCATCTCTTCACAGCCTGG + Intronic
1100092378 12:90986606-90986628 TCTCTCATCTTCCAACAGGCTGG - Intronic
1100625703 12:96329124-96329146 TCCCTCCTCTCCCCAGCCCCTGG - Intronic
1101086900 12:101245396-101245418 TTCCTCATCTGCCCATATCCAGG + Intergenic
1101308422 12:103554307-103554329 TCCCTTTTCTCCCCACCACCTGG - Intergenic
1101503972 12:105330391-105330413 TTCCTCTCCTCCCCACATCCTGG + Intronic
1101930084 12:109006678-109006700 GCCCTCATCACCCCAGAACCAGG - Intronic
1102349044 12:112178881-112178903 CCCCACATCTGCCCACAGGCTGG + Intronic
1102421003 12:112802848-112802870 TCTGTCCTCTCCCCAGAGCCTGG + Intronic
1102640464 12:114362122-114362144 TCCAGCTTCTCCCCACACCCTGG + Intronic
1102923613 12:116810632-116810654 TCCCCCAGCACCCCACAGCAGGG - Intronic
1103149229 12:118622617-118622639 GCCCTAATCACCCCAGAGCCCGG + Intergenic
1103381479 12:120496928-120496950 TCCCTCAACTCCCCACTGGAAGG - Intronic
1103430591 12:120881895-120881917 TCCCCTCTCTCCCCACACCCTGG - Intronic
1104480432 12:129103173-129103195 TCCCTCCTCTTCCTCCAGCCTGG - Intronic
1104643325 12:130481044-130481066 TCCCTCGCCTCCCCCCTGCCAGG - Intronic
1106140250 13:27005814-27005836 GCCCTGATCACCCCAGAGCCAGG - Intergenic
1107281874 13:38745887-38745909 TTCCCCAGCTCCTCACAGCCAGG + Intronic
1107999246 13:45891220-45891242 TTTCTCATCTCCTTACAGCCAGG - Intergenic
1108509175 13:51139371-51139393 TTCCTCATCTCCCCAGCCCCTGG - Intergenic
1108550479 13:51539019-51539041 CGCCTCATCTCCACCCAGCCAGG + Intergenic
1108714920 13:53069473-53069495 TCCTTCATCTTCTCTCAGCCAGG - Intergenic
1109084408 13:57951480-57951502 TCCCTAAGCTCCACACAGCATGG + Intergenic
1109415656 13:62036125-62036147 TCCCTTATCTGCTCACAGACAGG + Intergenic
1112487673 13:99834543-99834565 GCCCACATCTCCGCAGAGCCAGG + Intronic
1113536424 13:111070172-111070194 TCCCCCATCTCCCCAACTCCTGG + Intergenic
1114522413 14:23347679-23347701 TCCCTCCTCCTCCCACAGGCTGG + Exonic
1114580123 14:23749466-23749488 TGCCTCCTCTCCACACTGCCTGG - Intergenic
1115880362 14:37910406-37910428 TTCCTCTTCTCACCACAGACTGG - Intronic
1117301730 14:54436860-54436882 GCCCACATCTCCACACAGCATGG + Intronic
1117359520 14:54959388-54959410 TCCCTCCTCTTCCCCCCGCCAGG - Intronic
1118305779 14:64654022-64654044 ACCCTTATATCCCCAAAGCCTGG + Intergenic
1119751014 14:77077295-77077317 ACCCTCATCTCTGCTCAGCCGGG - Intergenic
1121001543 14:90454886-90454908 TCCCTTTCCTCCCCAGAGCCTGG + Intergenic
1121009464 14:90511542-90511564 TCCCTGATCTCTGCCCAGCCTGG - Intergenic
1121336382 14:93079901-93079923 CACCTCATCACCCCACAGACAGG + Intronic
1121519648 14:94577267-94577289 TCACTCCTCTCCACCCAGCCAGG + Intronic
1121734108 14:96205969-96205991 GCCCCCATCACCCCACACCCAGG - Intronic
1121812101 14:96900467-96900489 TCCCTCACCCCCCCATAGGCAGG - Intronic
1121989084 14:98537544-98537566 ACCCTCATGACCACACAGCCAGG - Intergenic
1122008700 14:98728043-98728065 ATCCTCATCCCCCCACAACCAGG + Intergenic
1122852654 14:104545418-104545440 TGCCTCATCCCCGCACCGCCCGG + Intronic
1123012945 14:105357992-105358014 CTCCTGGTCTCCCCACAGCCTGG - Intronic
1123038358 14:105480405-105480427 TTCCTTACCTCCCCACAGCCTGG - Intergenic
1123051463 14:105546175-105546197 TCCCTCATCTCCCCACGGGCAGG + Intergenic
1123076878 14:105671878-105671900 TCCCTCATCTCCCCACGGGCAGG + Intergenic
1124377857 15:29140009-29140031 TCCCTCCTCGCCCCGCAGGCCGG - Intronic
1125673897 15:41492641-41492663 TCCCTTCTCTCCCCTCAGCCAGG - Intergenic
1125746601 15:42001279-42001301 TCCCTCATCTCCCTTCAGCCTGG - Intronic
1127716770 15:61655909-61655931 TCCATCAGGTCCCCACAACCTGG + Intergenic
1127842094 15:62840585-62840607 GCCCTCATCTTCCCTCAGCTCGG - Exonic
1128249400 15:66153926-66153948 CCCCTCATCCCCCCACTGGCTGG + Intronic
1128353646 15:66908996-66909018 TCCCTGATCTGCCCAAGGCCAGG - Intergenic
1128385439 15:67144953-67144975 TCCCTCATCCTCACAAAGCCAGG + Intronic
1128512684 15:68323154-68323176 CCCCTCAGCTCCCCACCGCAAGG + Intronic
1129363416 15:75039258-75039280 TACCACATCTCCCTACTGCCAGG + Intronic
1129676490 15:77634717-77634739 TCCCTCAACTCCGCGCTGCCTGG + Intronic
1129831483 15:78673872-78673894 TCCCTCATCTGCACCAAGCCAGG + Intronic
1130903240 15:88222991-88223013 TCCCTCCTCTCCCCACTTCTTGG - Intronic
1131065266 15:89430726-89430748 TCCCTGAGCACCGCACAGCCTGG - Intergenic
1131121681 15:89827006-89827028 TCCCTTATCTGCCCACTTCCAGG - Intergenic
1131166117 15:90143380-90143402 TCCTTTATCACACCACAGCCAGG + Intergenic
1131525921 15:93152489-93152511 TCCCTCACCTCCCCACTGCTGGG - Intergenic
1132020400 15:98356500-98356522 TCCCTCTTCTCCACACACCAGGG - Intergenic
1132282128 15:100628568-100628590 TCCGTCTTCTGCCCCCAGCCAGG + Intronic
1132500873 16:284161-284183 CCCCCCCTCCCCCCACAGCCAGG - Intronic
1132643790 16:989690-989712 CACCTCTGCTCCCCACAGCCTGG + Intergenic
1132840640 16:1977000-1977022 TCCCCCATCTTCCCCCAGCAAGG - Intronic
1133104048 16:3495350-3495372 TGCCACTCCTCCCCACAGCCCGG + Intronic
1133236425 16:4389328-4389350 CCCCTCAGCTCCCCACTGCCAGG - Intronic
1133326325 16:4944524-4944546 GCCCTGGTCTGCCCACAGCCGGG + Intronic
1133770347 16:8863986-8864008 GCCTTCAGCTCCCCACAGCTGGG + Intronic
1133939570 16:10297091-10297113 TCCCTTATCTACCTAAAGCCCGG - Intergenic
1134128037 16:11629855-11629877 GCGCTCTTCCCCCCACAGCCTGG + Intronic
1135435814 16:22425936-22425958 TCCCTCTTGTCCCTGCAGCCTGG - Intronic
1135983918 16:27169556-27169578 TCCCTCATCTCCCAGAATCCTGG - Intergenic
1136598018 16:31265377-31265399 TCCCACTTCTCCCCACAGGGTGG + Exonic
1137716391 16:50600920-50600942 GCCTTCAGCTCCCCACATCCTGG - Intronic
1138207945 16:55138593-55138615 CCCCTCCTCACCCCTCAGCCTGG - Intergenic
1138465243 16:57185639-57185661 ACCCTCAGCTCCCCTCAGGCTGG + Intronic
1139291923 16:65867215-65867237 TCCCTCATCTCTGCAAAGCCAGG - Intergenic
1139653729 16:68375298-68375320 TCCCTCATCCACCCCCACCCTGG + Intronic
1140759315 16:78097096-78097118 TCCTTCCTCTCCCCACAATCAGG + Intergenic
1141602344 16:85134412-85134434 TTCCCCATCTCCCCATGGCCGGG + Intergenic
1141650279 16:85389083-85389105 TCCCTCCTCTCCCCAGGACCTGG - Intergenic
1141882509 16:86869336-86869358 CCCCTCAGCTCCTCTCAGCCTGG - Intergenic
1142070082 16:88087061-88087083 TCACCCATCTTCCCACAGCCCGG - Intronic
1142399724 16:89852554-89852576 TCCGTCCTCTCCCCACCCCCTGG + Intronic
1142502117 17:339035-339057 CCCCTCACCTCACCAGAGCCAGG + Intronic
1142503721 17:349414-349436 ACCCACATCTCCCAACATCCAGG + Intronic
1143100116 17:4499984-4500006 TCCCTCCGCTCCCCGCAGCCCGG - Intronic
1143328506 17:6117448-6117470 CCTCTCACCTCCCCACAGTCAGG - Intronic
1143417872 17:6763124-6763146 TCCCTCATCTTCCCAGTTCCTGG + Intronic
1143741062 17:8954432-8954454 GCCCTGATTGCCCCACAGCCTGG + Intronic
1144961133 17:19044803-19044825 TCCCTCAGCTCCAGACACCCTGG - Intronic
1144974028 17:19129721-19129743 TCCCTCAGCTCCAGACACCCTGG + Intronic
1145974935 17:28978462-28978484 TCCCTCAGATCCCCAAAGCCTGG - Intronic
1146127884 17:30243297-30243319 TACCTATTCTCCCCACTGCCAGG + Intergenic
1146162299 17:30566484-30566506 CCCCTCATTTCCCCAAAACCTGG + Intergenic
1147341663 17:39756183-39756205 TCCCCCCTCTCCCCTAAGCCAGG + Intergenic
1147422342 17:40328124-40328146 TCCCTCAGTTCCACACAGGCTGG + Intronic
1147578697 17:41616898-41616920 CCCCTCATCTCCCCAAAACCTGG + Intergenic
1147678382 17:42223150-42223172 TCACTCAGGTCCCCACATCCAGG - Intronic
1147935507 17:44008426-44008448 TACATCACCTCCCCACACCCAGG + Exonic
1147978455 17:44260954-44260976 TCCCTTATCTCCCAACTTCCTGG + Intronic
1149005762 17:51803428-51803450 TCCCTCTTCTCTCCAAATCCCGG + Intronic
1149542465 17:57477966-57477988 TCTCTCTTCTCCCCACTGCTAGG + Intronic
1149553335 17:57555881-57555903 ATCCTCCTCTCCCTACAGCCAGG + Intronic
1150237540 17:63605184-63605206 TACCTCATCTCCCTACAACTTGG - Intronic
1151357820 17:73570909-73570931 TTCCTCCTCAGCCCACAGCCTGG + Intronic
1151659205 17:75509805-75509827 GCCCTCCTCTTCCAACAGCCTGG + Intronic
1151680713 17:75621327-75621349 TCCCTCTGCCCCCCACAGGCTGG + Intergenic
1151918339 17:77135379-77135401 TTCCTCAACTCCCCAGAGACTGG + Intronic
1152035503 17:77869768-77869790 CACCTGATCTGCCCACAGCCTGG - Intergenic
1152206658 17:78977863-78977885 TCCCTGTTCTTCCCCCAGCCTGG - Intronic
1152265394 17:79291283-79291305 TCGCTCTTTTCCCCACACCCAGG - Intronic
1152540378 17:80971663-80971685 CCACTCAGATCCCCACAGCCTGG + Intergenic
1153321076 18:3774864-3774886 TCCCTCATCTGCCTAAAGTCTGG + Intronic
1153908772 18:9688010-9688032 TTTCTCATCTCCCAACAGCAAGG + Intergenic
1153973768 18:10248802-10248824 GCCAGCATCGCCCCACAGCCTGG + Intergenic
1154043050 18:10877639-10877661 TCCCCTTTATCCCCACAGCCCGG + Intronic
1155169266 18:23255087-23255109 GCCCTTATCACCCCAGAGCCAGG - Intronic
1155171505 18:23270143-23270165 TCCCTAGCCTCCCCACAGCAGGG - Intronic
1155315702 18:24568259-24568281 GCCTTAATCACCCCACAGCCAGG - Intergenic
1155316040 18:24571007-24571029 TGCATCTTCTCCCCACAGCATGG - Intergenic
1155828882 18:30486382-30486404 TCCCTCATCAACCTACATCCTGG - Intergenic
1157751513 18:50182829-50182851 CCCCCCAACCCCCCACAGCCTGG - Intronic
1160048011 18:75405898-75405920 TCCTTCATCCACACACAGCCGGG - Intergenic
1160273855 18:77411981-77412003 TCCCTGCTTTCCCCAGAGCCAGG + Intergenic
1160497836 18:79385459-79385481 TGCCTCATCGCCCCACAGTCTGG + Intergenic
1160499947 18:79396517-79396539 TCCCCCAGCTCCCAGCAGCCCGG + Intronic
1160582958 18:79898205-79898227 TCCTTCATCTCCCTCCAGGCAGG + Intronic
1160866850 19:1259936-1259958 TGCCTCATCTCTGCCCAGCCCGG - Intronic
1160965243 19:1744529-1744551 GCCCCCCTCCCCCCACAGCCCGG - Intergenic
1161038799 19:2099237-2099259 AGCCTCGTCTCCCCGCAGCCTGG + Exonic
1161151317 19:2711541-2711563 TCCCTCCACTCCTCCCAGCCAGG + Intergenic
1161266192 19:3365909-3365931 TCCCTTCTCCCCCCAGAGCCAGG - Intronic
1161355833 19:3819231-3819253 TGCGGCCTCTCCCCACAGCCCGG - Exonic
1161495033 19:4581804-4581826 CCCCCCACCTCCCCAAAGCCGGG + Intergenic
1162017960 19:7855935-7855957 CCCCTCATTTACCCACTGCCGGG - Intronic
1162583597 19:11545607-11545629 TCCCTCATCTCCCTGCAGCTTGG - Intronic
1162924776 19:13924854-13924876 TCCCCCATCTCCACACAGCCTGG + Intronic
1163161130 19:15464595-15464617 TCCCACCCCACCCCACAGCCAGG + Intergenic
1163261063 19:16190358-16190380 TCCCTCAACTCCACCCAGGCTGG - Intronic
1164612463 19:29641938-29641960 TCCCGTATCTCCCCACAGACAGG + Intergenic
1165236946 19:34428886-34428908 TCCCGCATCTCCTAACAGCCGGG - Intronic
1165284686 19:34832198-34832220 TTCCCCATCTCACCCCAGCCAGG - Intergenic
1165375073 19:35436078-35436100 TCACTCATCCATCCACAGCCTGG - Intergenic
1165906907 19:39199911-39199933 TCCCTGATCACCCCTCAGCTGGG + Intronic
1166699613 19:44874601-44874623 ACCCTCATCTCCCCTCAGCCAGG - Intronic
1166782993 19:45352044-45352066 TCCCCCTTCCCCCCAGAGCCTGG + Intronic
1166984069 19:46649324-46649346 CCCCTCACCCCCCGACAGCCCGG - Exonic
1167142340 19:47660704-47660726 TCCCTCCACCCCCCACAGCAGGG - Intronic
1167175424 19:47860967-47860989 TCCTGGATCTCCCCTCAGCCGGG + Intergenic
1167230241 19:48278365-48278387 TCCCTCATCTCCCCCAGCCCTGG + Intronic
1167432056 19:49460889-49460911 GCCATCATTTACCCACAGCCAGG - Exonic
1167600549 19:50451984-50452006 CACCTCATCTCCCTTCAGCCAGG - Exonic
1167715163 19:51138301-51138323 ACCCTCTTCTCCCCACTCCCAGG + Intergenic
1167776987 19:51564869-51564891 CCCCTCACCTCCCCACAGCAGGG + Intergenic
1167785207 19:51630291-51630313 TCACTCACCCCCCCACAGCAGGG + Intronic
1167787306 19:51646715-51646737 TCACTCACCCCCCCACAGCAGGG + Exonic
1168099046 19:54131291-54131313 TCCCTCACCTGCCCAGGGCCTGG + Exonic
1168148498 19:54432519-54432541 GCCCTCTGCCCCCCACAGCCAGG + Intronic
1168396606 19:56053837-56053859 TCCCCCACCTCCTCCCAGCCCGG - Intronic
924960027 2:26424-26446 TCCCTAATCACCCCAGGGCCAGG - Intergenic
925174302 2:1771474-1771496 TCTCTCATTTTCCCACAGCTGGG + Intergenic
925389799 2:3487032-3487054 TCTGGCTTCTCCCCACAGCCTGG - Intergenic
925465937 2:4107385-4107407 TCCCACATCTCCCCAGGGGCTGG - Intergenic
926125275 2:10268019-10268041 TCCCTCAGATGCCTACAGCCAGG + Intergenic
926527998 2:14006826-14006848 TCCCCCATCTCCCCATCACCTGG - Intergenic
926730334 2:16031250-16031272 TCCCTCCCCACCCCACAGCCTGG + Intergenic
928698976 2:33879829-33879851 TCCCTTAGATCCCCACAACCGGG - Intergenic
929903979 2:46030107-46030129 TCCCTGAGATCCCCACATCCTGG + Intronic
929998823 2:46847331-46847353 TCCCTCACCTTCTCACTGCCTGG + Intronic
932444756 2:71771488-71771510 ACCCTAATCACCCCAGAGCCAGG - Intergenic
932976206 2:76602570-76602592 TCCCTAAGCTGCACACAGCCTGG + Intergenic
933194564 2:79373612-79373634 TCCCTCCTCTCCCTCCATCCAGG - Intronic
934500060 2:94852292-94852314 TCCCTGTTCTACCCATAGCCAGG - Intergenic
934522690 2:95030012-95030034 TGCCTGACCTCCCAACAGCCTGG + Intronic
934553370 2:95275383-95275405 TCCCTCCTCTCCCCACTGCCAGG - Intronic
935693368 2:105749753-105749775 TCTCTCTTGTCCCCACATCCTGG + Intronic
936066589 2:109337276-109337298 CCTCTCCTCTCCCCACAGCAGGG + Intronic
937125675 2:119473789-119473811 TCCCCCTTCTCACCCCAGCCGGG + Intronic
937281893 2:120723064-120723086 ACCTTCATTTCCTCACAGCCTGG - Intergenic
937434293 2:121867497-121867519 TCCCTCTTTTCCCCACGTCCAGG + Intergenic
938084150 2:128387235-128387257 TCCCACATCTGCCCCCAGGCAGG + Intergenic
938397681 2:130963297-130963319 ACCCTCATCTGCGCTCAGCCAGG - Intronic
938409944 2:131055445-131055467 TCTCTCTTCTCCCCACAGCAAGG - Exonic
938778151 2:134560021-134560043 TCGCTGACCTCCCCACAGCCAGG + Intronic
939789325 2:146552159-146552181 TTCCTCATCTGCCCACAGAAAGG + Intergenic
940181154 2:150934725-150934747 TCCCCCATCTGCCTACAGGCAGG + Intergenic
944024939 2:195153131-195153153 GCCTTCAACTCCCCACAGCCCGG + Intergenic
945185758 2:207137838-207137860 TCCCTCATCTTTCCCCAGCCAGG - Intronic
945649332 2:212538941-212538963 TCCGGCCTCTCCCCGCAGCCGGG + Intergenic
945812775 2:214568844-214568866 CTCCTCTTCTCCCAACAGCCTGG + Intronic
946181575 2:217952226-217952248 TCCCTCCTCTCCCCATACCTGGG + Intronic
948088243 2:235268141-235268163 TCCCTCCTCTCCTCCCATCCTGG + Intergenic
948651986 2:239452704-239452726 TCCTTCATGTCCCCACAGTTTGG - Intergenic
949060509 2:241953823-241953845 TCCGGCTCCTCCCCACAGCCTGG - Intergenic
949082234 2:242111574-242111596 GCCCTTAACTCCCCACACCCAGG - Intergenic
1168807857 20:683195-683217 TCCATCGTCTACCCAGAGCCGGG + Intergenic
1169344756 20:4821461-4821483 TCCCTGGTCTCCTCTCAGCCAGG + Intronic
1169448381 20:5690986-5691008 TCCCTCTTCTGCCCATGGCCTGG - Intergenic
1169889058 20:10433694-10433716 GCCCCCACCTCCCGACAGCCTGG + Intronic
1169992771 20:11522132-11522154 TCCCTTTTCTCCCAACAGCAAGG + Intergenic
1170747763 20:19115864-19115886 TCCCTCATCTCCTCTCACCCTGG + Intergenic
1171959972 20:31486191-31486213 CACCACATCTCCCCAGAGCCTGG - Intergenic
1172022159 20:31922453-31922475 TCCCTCCTCTCCCCAGCCCCTGG + Intronic
1172219497 20:33263767-33263789 TCCCTCATTCCCCCACAGAGGGG + Intergenic
1172395964 20:34605466-34605488 CCCCTCATCGCCCCACATACTGG + Intronic
1172399591 20:34638299-34638321 TCCCTCACCACCCCACACCCAGG + Intronic
1172520177 20:35560984-35561006 TCCCTCTTCTCCCTGCAGACTGG - Intergenic
1172941762 20:38659147-38659169 GCCCACACCTGCCCACAGCCAGG - Intergenic
1172962306 20:38807337-38807359 TCCCTCATCTCCCCACAGCCTGG - Intronic
1173166888 20:40691873-40691895 TCCGTCATTCACCCACAGCCTGG - Intergenic
1173249497 20:41357199-41357221 TCCCTCCCCTTCCCACAGCTGGG - Intronic
1173417525 20:42870161-42870183 TCCCTCCTCTCCCCAGCCCCTGG + Intronic
1173907860 20:46641910-46641932 GCCCTAATCACCCCAGAGCCAGG + Intronic
1174195447 20:48769579-48769601 TCCCTCATCTCCTCCCACACTGG + Intronic
1174355049 20:49991899-49991921 TCCCTCTTCTGCCCACAGAAGGG - Intergenic
1175445424 20:59016381-59016403 TGCCTTATCTCCCGCCAGCCTGG - Intergenic
1175445440 20:59016496-59016518 TCCATGATCTTCCCACAGGCAGG - Intergenic
1175767322 20:61600421-61600443 TCCCTCAAGGCCCCAGAGCCAGG - Intronic
1176225970 20:63999650-63999672 ACCCTCATCACCCGCCAGCCTGG + Exonic
1176269982 20:64231289-64231311 TCCCTCAGCTCCCCAAGTCCTGG + Intronic
1176312262 21:5158394-5158416 TCTCTGATGTCCCCACGGCCAGG + Intergenic
1178057949 21:28820307-28820329 TCCCTCATCTGCCTAAAGTCTGG + Intergenic
1178064853 21:28893549-28893571 TTACTCTTCTCCCCACAGCCTGG + Intergenic
1178899755 21:36589477-36589499 TCCCTCCTCCCTCCCCAGCCTGG + Intergenic
1178902061 21:36606066-36606088 TCCTTCGCCTCCCCAGAGCCAGG + Intergenic
1179058233 21:37955496-37955518 TCCCTCATCACCCCCCAGATGGG - Intronic
1179112054 21:38455868-38455890 TCCCCCCCCTCCCCACAGACAGG + Intronic
1179426600 21:41284412-41284434 GCCCTCATCACCCCAGAGCCAGG + Intergenic
1179844786 21:44103636-44103658 TCTCTGATGTCCCCACGGCCAGG - Exonic
1180100904 21:45584931-45584953 CCCCTCGTCTCCCCCAAGCCTGG - Intergenic
1180609723 22:17087322-17087344 TCCCTCATTTCCACAAAGGCAGG + Intronic
1181009054 22:20029586-20029608 TCCCTCAACACCCCCAAGCCTGG - Intronic
1181072302 22:20352817-20352839 AGGCTCATCTCCCCACAGACAGG + Intronic
1181171121 22:21010809-21010831 GCCCTCTCCACCCCACAGCCTGG + Intronic
1181178224 22:21049710-21049732 GCCCTCTCCACCCCACAGCCTGG - Intronic
1181570795 22:23767022-23767044 CCCCTGTTCTCCCCACACCCAGG - Intronic
1181992330 22:26846994-26847016 CTCCCCATCTCCCCACATCCAGG + Intergenic
1182325768 22:29511509-29511531 TGCCTCATATGCCCACAGCCAGG + Intronic
1182434285 22:30320388-30320410 TCCCTGAGGTCCCCACACCCAGG - Intronic
1182634267 22:31712016-31712038 CCTCTCATCTCCCCAGAGACAGG + Intronic
1183745462 22:39689137-39689159 TCCCCACTTTCCCCACAGCCAGG - Exonic
1184283681 22:43453945-43453967 TCCCTCCTCTCCCCAGCCCCTGG + Intronic
1184429873 22:44436185-44436207 CCCCTGACCTCCCCAGAGCCTGG + Intergenic
1184657603 22:45949691-45949713 ACCTTCATCTGCACACAGCCTGG + Intronic
1184817307 22:46881963-46881985 TCACACATCTGCCCTCAGCCAGG + Intronic
1185127957 22:49022256-49022278 TCTCTGCGCTCCCCACAGCCTGG - Intergenic
1185154770 22:49186733-49186755 TCCCTCCTCCACCCACAGCCAGG - Intergenic
1185211859 22:49575072-49575094 GGGCTCATCTCCCCGCAGCCAGG + Intronic
1185277632 22:49956701-49956723 TGCGTCATCTCCCCGCAGACCGG - Intergenic
1185285351 22:49997479-49997501 ACCCTTCACTCCCCACAGCCTGG - Intronic
949215988 3:1567987-1568009 TCCCTTATCTGCCTAAAGCCTGG + Intergenic
950458693 3:13108053-13108075 TCACTCATAACCCCACCGCCTGG + Intergenic
950520155 3:13493314-13493336 TCCCTCTCCTCCCCTCACCCAGG + Intronic
950624452 3:14234552-14234574 TTCCTCATCTCACCCCACCCAGG - Intergenic
950663636 3:14482061-14482083 TTCCTCCTCACCCCACAGCCCGG - Intronic
950719984 3:14875773-14875795 TCCCTCCACTCCCTCCAGCCTGG - Intronic
952260190 3:31732656-31732678 TCTGTCATCTGCCCGCAGCCTGG - Intronic
954578725 3:51691461-51691483 TCCCTCCCCTCCCCACACCCAGG - Intronic
954584134 3:51719396-51719418 TCCCTCTGCTCCTCACAGTCTGG - Intergenic
955077830 3:55630518-55630540 TCCCCTTTCTCCCCACAGTCAGG - Intronic
956844485 3:73169882-73169904 TCCTTCAGCTCTCCACAACCTGG - Intergenic
957202191 3:77150224-77150246 TCCGTCATCTCCACTCGGCCTGG - Intronic
957947785 3:87087236-87087258 TCCCACATCTCCACATAGTCAGG + Intergenic
958079893 3:88733916-88733938 TCTCACATCTCCACCCAGCCTGG + Intergenic
958970281 3:100603495-100603517 TTCCTACTCTCCCCAGAGCCAGG - Intergenic
960927441 3:122808934-122808956 TCCCCCAACTTCCCACAGCATGG - Intronic
960945108 3:122961077-122961099 TCCCTGCTCTCCCCTCAGTCTGG + Intronic
961411904 3:126728311-126728333 TCCCTCTTCTCCCGTGAGCCTGG - Intronic
961426648 3:126853599-126853621 TCCCTCTTTTCCCCATGGCCTGG - Intronic
961632682 3:128312744-128312766 TCTCCCTCCTCCCCACAGCCTGG - Intronic
961735168 3:128996893-128996915 TGCCTCATCTCCTCATAGCCCGG + Intronic
961937779 3:130603885-130603907 TCCTTCATTCCCCCAAAGCCTGG - Intronic
962567607 3:136678936-136678958 GCCCTGCTCTCCCCACTGCCAGG - Intronic
962953254 3:140240978-140241000 TCCCTCATCTCCTGAGATCCTGG - Intronic
963055956 3:141186429-141186451 TCCCTCCTCTCCCCATTGCTGGG - Intergenic
964282259 3:155079795-155079817 TGCCTCGTCGCCCCACGGCCCGG + Intronic
964288247 3:155145384-155145406 TCCCTCATCTCACCCTAGGCTGG + Intronic
966828833 3:183988532-183988554 ACCCTCATCTCCCCCATGCCGGG - Intronic
966882639 3:184358926-184358948 TCCCTCAGCACAGCACAGCCAGG + Intronic
966913372 3:184571453-184571475 CCCCTCATCTCACCAGGGCCTGG + Intronic
968086483 3:195876237-195876259 TCTCCCCTCTGCCCACAGCCTGG + Intronic
968352856 3:198075848-198075870 TCCCTGTTCTACCCATAGCCAGG - Intergenic
968544539 4:1192029-1192051 CCCCTCATCTCTCCACAGCAAGG + Intronic
969301242 4:6298765-6298787 GCCCTCACCTGCCAACAGCCTGG - Intronic
969311404 4:6354815-6354837 GCCCACAGCCCCCCACAGCCAGG + Intronic
969502590 4:7562242-7562264 TTTCCCATCTCCCCACAGCCTGG - Intronic
969705960 4:8791785-8791807 TCCCTTCTCTTCTCACAGCCAGG + Intergenic
972846471 4:42997659-42997681 TCCCTGATCACCCCAGGGCCCGG + Intronic
974364339 4:60926918-60926940 TCCCTAATCACTCCAGAGCCAGG + Intergenic
975037707 4:69704786-69704808 CTCCTCATCTCCCACCAGCCTGG - Intergenic
975176843 4:71299432-71299454 TCTCCCAGCTCCCAACAGCCTGG - Intronic
975974380 4:80078480-80078502 ACACTAATTTCCCCACAGCCAGG - Intronic
977030163 4:91873409-91873431 TCCCTCACCACCCCACAAACCGG + Intergenic
978776918 4:112514669-112514691 CACCTCACCTCCCCATAGCCAGG - Exonic
979382099 4:120019247-120019269 TCCCTTCTCTCCCCACAGTAGGG - Intergenic
979531283 4:121771557-121771579 TCGCTCATCTTCCAACATCCTGG + Intergenic
982361852 4:154526945-154526967 TCCTTGATCTTCCCAGAGCCTGG - Intergenic
982446103 4:155492244-155492266 CCCCTGTTCTCCCCACAGCCTGG - Intergenic
984575796 4:181446824-181446846 TCCCTCCCCTCCCCACATCCTGG + Intergenic
984894665 4:184527427-184527449 TTGGTCACCTCCCCACAGCCGGG - Intergenic
984915192 4:184717356-184717378 TCCCACATCTTCCCATACCCAGG + Intronic
985200188 4:187476595-187476617 TGCCTCAGGACCCCACAGCCTGG - Intergenic
985469711 5:32451-32473 TCCCTAATCACCCCAGGGCCAGG - Intergenic
985776965 5:1849441-1849463 TCCCTCATGTGCGCACAGCACGG + Intergenic
986201101 5:5579473-5579495 TCCCTCCTCTGCCCACACACGGG - Intergenic
986573441 5:9188944-9188966 TTCCTCCTCTTCCCACAGACTGG + Intronic
986632279 5:9785142-9785164 TCTCTCATCTCCCCACAGCCAGG + Intergenic
986706491 5:10458306-10458328 TCCCTCATCTCCCCAGCTCTTGG + Intronic
987109551 5:14672441-14672463 TCCCTCATCACCCCAGCTCCTGG - Intronic
987828596 5:23065076-23065098 CCCCTAATCACCCCAGAGCCAGG + Intergenic
988688617 5:33549684-33549706 TCTATAATCTCCCCACAGCTGGG - Intronic
988949391 5:36241840-36241862 TGCCTCAGCTCCCTACCGCCGGG + Intronic
989206657 5:38816031-38816053 TCCCAAACCTCCCCCCAGCCAGG + Intergenic
989626178 5:43431397-43431419 ACCCTCCTCTGACCACAGCCAGG - Intergenic
991337767 5:65568548-65568570 CCATTCATCTCACCACAGCCAGG - Intronic
991645169 5:68794321-68794343 ACCCTCACTCCCCCACAGCCAGG + Intergenic
996336664 5:122390934-122390956 TCCTTCAACTGTCCACAGCCTGG - Intronic
997362149 5:133301948-133301970 ACCCTCCTCAGCCCACAGCCAGG + Intronic
997384530 5:133462307-133462329 TCCTCCCTCTCCCCACACCCTGG + Intronic
997795764 5:136809297-136809319 TTTCTCATCTTCTCACAGCCTGG + Intergenic
998253676 5:140568944-140568966 TCTCCCAGCTCCCAACAGCCTGG + Exonic
998497598 5:142604102-142604124 TCCCCCATCTCCACCCACCCTGG - Intronic
999386466 5:151157435-151157457 TCCCTCCCCTCCCCCTAGCCAGG + Intronic
1000046998 5:157530260-157530282 TCCCTAATCACCCCAGAACCAGG + Intronic
1001630041 5:173168252-173168274 TCGCTCCCCACCCCACAGCCTGG + Intergenic
1001631809 5:173180947-173180969 CCCCTCTCCTCCCCACAGCTGGG + Intergenic
1001889656 5:175328336-175328358 TCCAGCCTCTCCCCACAGTCTGG + Intergenic
1001991024 5:176115448-176115470 CCCCTGAGCTCCCCACAGTCAGG - Intronic
1002334476 5:178468515-178468537 TCCCTCATCTGCTCACACCCAGG + Intronic
1003129249 6:3381243-3381265 TTCCTCACCTCCCCACAGAGAGG - Intronic
1003519016 6:6841870-6841892 CCCTTCATCTCCCCAGACCCTGG + Intergenic
1004573780 6:16873105-16873127 GTCATCATCTCCCCCCAGCCAGG - Intergenic
1005958974 6:30683225-30683247 ACACACATCTCCCCAGAGCCTGG - Intronic
1005959504 6:30685627-30685649 TCCCGCATCTCCCCAGGGCTGGG + Exonic
1006405509 6:33842662-33842684 CCCATCATCTCCACCCAGCCAGG + Intergenic
1008132362 6:47733334-47733356 TGTCTTCTCTCCCCACAGCCAGG + Intergenic
1008224300 6:48894157-48894179 TCCCTCATCTTCACACAACCAGG - Intergenic
1010032855 6:71288693-71288715 TCCTTCTCCTCCCCACAGGCGGG - Intergenic
1011693030 6:89887481-89887503 TCCCTCACCGCCCCACCGTCAGG + Intergenic
1012052426 6:94361936-94361958 AGCCACATCTCCCCCCAGCCTGG + Intergenic
1014730988 6:125031151-125031173 TCCCTCAGCTGCACACACCCTGG + Intronic
1014774957 6:125497851-125497873 TCTATCATCTCCCCACAACTTGG + Intergenic
1016038009 6:139403059-139403081 TTCCTCCTCTCCTCTCAGCCAGG + Intergenic
1016157059 6:140823576-140823598 TCCCTCATCTTCCCAGAACAGGG + Intergenic
1016990396 6:149924416-149924438 TCCCTCATCTTCCCACATGAAGG + Intergenic
1017011118 6:150064485-150064507 TCCCACCTCTCCCCATGGCCGGG - Intronic
1017853608 6:158328668-158328690 TCCCTCCTCCCCACACAGCGGGG - Intronic
1018211501 6:161487086-161487108 TACCTCATCGCCCCTCAACCAGG - Intronic
1018801094 6:167222710-167222732 TCCCCCATCCCTCCCCAGCCCGG + Intergenic
1018809039 6:167284461-167284483 TCCCCCATCCCTCCCCAGCCCGG - Intronic
1019280469 7:197309-197331 CCCCTCCTCTCCACACGGCCTGG - Intronic
1019886315 7:3909013-3909035 TTCCTCATCTCCTCCCACCCTGG - Intronic
1020408205 7:7861088-7861110 TCCCTCCTCTCCCCAAGCCCTGG - Intronic
1022094365 7:27129974-27129996 ACCCACATCTCACCGCAGCCCGG + Intronic
1022387524 7:29915612-29915634 GCACACATCTCCCCACAGACAGG - Exonic
1023333062 7:39139750-39139772 TCCCTCATGTCCACACTGTCTGG - Intronic
1023334294 7:39152269-39152291 TCACTTATCCACCCACAGCCTGG - Intronic
1024567572 7:50694622-50694644 TCCCTCACCTACCCACAGGCTGG + Intronic
1024706928 7:51971239-51971261 TTCCTCAACTCCTCACAGCTGGG - Intergenic
1025978012 7:66384919-66384941 TGCCTCAGCTCCCCACTGGCTGG + Intronic
1026487193 7:70831590-70831612 TCCCTCCTCCCCCTACACCCTGG + Intergenic
1027203594 7:76079586-76079608 TGCCTCAGCTCCCCACTGGCTGG + Intergenic
1027545834 7:79526511-79526533 TCCCTGAGCCCCCCACACCCTGG + Intergenic
1028599244 7:92583298-92583320 TTCCTCTTCTCCCCAGACCCTGG - Intronic
1029506779 7:100967784-100967806 TCCCTCCTCTCCTCACATCCTGG + Exonic
1030114802 7:106055012-106055034 TTCCTCATCTCCCCACACTCTGG + Intergenic
1030889908 7:114986649-114986671 TTTCTCCTCTCCCCTCAGCCTGG + Intronic
1032474354 7:132202227-132202249 TTCTTCACCTCCCCAGAGCCAGG + Intronic
1033653780 7:143360713-143360735 TCACTTCTCTCCCCACAGTCAGG - Intronic
1035331373 7:158099120-158099142 TCCTTCCTCCCCCCACAACCCGG + Intronic
1036245271 8:7110782-7110804 ACCCCCTTCTCCCCACAGCAGGG - Intergenic
1036407612 8:8468959-8468981 TCCCCCAGCTTCCCACAGCTTGG - Intergenic
1037581539 8:20248673-20248695 TTCCTCCTCTGCCTACAGCCAGG - Exonic
1037833310 8:22201571-22201593 ATCCTCCTCTCCCCACAGCTGGG + Intronic
1038679556 8:29654100-29654122 TCCTGCATCGCCCCCCAGCCAGG + Intergenic
1039566146 8:38553913-38553935 TCTCCCAACTCCCCGCAGCCGGG + Intergenic
1040384341 8:46903563-46903585 TGTCTCATCTCCCCAGAGCAGGG - Intergenic
1040500735 8:48002680-48002702 TCCCCAATCCCCCCACACCCTGG - Intergenic
1040535028 8:48301680-48301702 TCTCTCATCACCCAGCAGCCTGG + Intergenic
1042108595 8:65355569-65355591 TCCCTCATCTCCTCACTGGGTGG - Intergenic
1042779205 8:72471049-72471071 TCCATCAAATCCCCAAAGCCAGG - Intergenic
1042860752 8:73310787-73310809 TCCCTCATCTTTCCCCTGCCGGG - Intronic
1044264490 8:90165988-90166010 TCCTTCAACTCCCAACAGCTAGG - Intergenic
1044607113 8:94057309-94057331 GCCCTAATCACCCCAAAGCCAGG - Intergenic
1044900033 8:96934455-96934477 TCCCTCATCTCCTCACCTCTGGG + Intronic
1046873845 8:119231902-119231924 TCCCCCATCACCCCATACCCTGG - Intronic
1047213320 8:122857240-122857262 CACCTAATCTCCCCATAGCCTGG + Intronic
1047356523 8:124127426-124127448 TAACTGAGCTCCCCACAGCCGGG + Intergenic
1047669269 8:127126720-127126742 TCCCTCATCTCCAGACAGCATGG + Intergenic
1048257639 8:132917202-132917224 TCACTGATCTCTCCCCAGCCAGG - Intronic
1048790651 8:138100379-138100401 TCCATAATCTCCCCACATCATGG - Intergenic
1048880995 8:138872426-138872448 TCTCTCCTGTCCCCACAGCCAGG - Intronic
1049399350 8:142417986-142418008 TCCCAGAGCTCACCACAGCCGGG - Intergenic
1050129006 9:2390074-2390096 TCTCTCTTCTCTCCCCAGCCAGG - Intergenic
1050166578 9:2770639-2770661 TCCCTCCACCCCCCGCAGCCAGG - Intronic
1051324218 9:15947358-15947380 TCCCCCATCTCCCTAGATCCTGG + Intronic
1051369444 9:16345736-16345758 TCCCTCATAGCACCACAGCCTGG + Intergenic
1051392384 9:16580043-16580065 TTCCTCATTGCCCCACACCCAGG + Intronic
1051677146 9:19569950-19569972 TCCCTCATCTCCCAACTCACAGG + Intronic
1053066940 9:35075581-35075603 TCTGGCATCTTCCCACAGCCGGG + Exonic
1053072803 9:35111186-35111208 CTCCTCTCCTCCCCACAGCCTGG + Exonic
1053502784 9:38614710-38614732 TCCCTGATATACCCACACCCAGG - Intergenic
1053657113 9:40228244-40228266 TCCCTGTTCTACCCATAGCCAGG + Intronic
1053907475 9:42857539-42857561 TCCCTGTTCTACCCATAGCCAGG + Intergenic
1054369230 9:64374524-64374546 TCCCTGTTCTACCCATAGCCAGG + Intronic
1054676861 9:67864272-67864294 TCCCTGTTCTACCCATAGCCAGG + Intronic
1054768821 9:69066084-69066106 TCCCTCATCCCTCAGCAGCCTGG + Intronic
1054954197 9:70889244-70889266 TGCCTCCTCTCCACATAGCCAGG + Intronic
1056388603 9:86119625-86119647 ACCCTAATCACCCCAGAGCCAGG - Intergenic
1056966682 9:91168366-91168388 TGCCTCATCTCCCACCACCCTGG + Intergenic
1057304625 9:93904929-93904951 TGCCACATCCCCCCAAAGCCAGG - Intergenic
1057402908 9:94740250-94740272 TCCTACATCACCCCACAGCCAGG - Intronic
1057704915 9:97389414-97389436 TTCCCCATCTGCCAACAGCCTGG + Intergenic
1058175245 9:101728351-101728373 TCACTCCTCTCCTCACCGCCAGG - Intronic
1058938470 9:109791395-109791417 TCTCTCATCCCCTCTCAGCCTGG + Intronic
1058991088 9:110256005-110256027 TCCCTCATCTTCCTCCAGTCGGG + Intronic
1059440999 9:114306720-114306742 TGCCCCAGCTCCCCACCGCCAGG - Intronic
1060250899 9:121986199-121986221 TCCACCAGCTCCCCACAGCTTGG + Intronic
1060266326 9:122113581-122113603 TCACTCATCTCCCCATAGTGAGG - Intergenic
1060316420 9:122515504-122515526 TCCCTCATCTCCCCACAACGTGG - Intergenic
1060602574 9:124888038-124888060 GCCCTCTTCTCCCCACCCCCTGG - Intronic
1060791727 9:126489821-126489843 TACCTCATCGTCCCTCAGCCAGG + Intronic
1061113626 9:128593738-128593760 TCCCCCACCTCACCCCAGCCTGG + Intronic
1061599980 9:131662167-131662189 TCTCTCCTCTCCCCACCACCAGG + Intronic
1061847895 9:133398113-133398135 AGCCTCAGCTCCCCACAGGCCGG - Intronic
1062272056 9:135714233-135714255 TCCCTGATCCCCCAAGAGCCAGG - Intronic
1062273997 9:135722104-135722126 TCCTCCATGCCCCCACAGCCAGG - Intronic
1062344300 9:136107736-136107758 TCTCTCTTCTCCCCACAGCCTGG - Intergenic
1062401901 9:136376494-136376516 TCACTCTTGTCCCCACTGCCTGG - Intronic
1062423162 9:136493763-136493785 CCCCTTCTCTCCCCACTGCCTGG - Intergenic
1062440476 9:136567306-136567328 ACCCTCCCCCCCCCACAGCCCGG - Intergenic
1062488670 9:136793535-136793557 TCCCTCCTCTCCCAGCAGCCAGG - Intronic
1062539421 9:137035024-137035046 CCCCTCATCTCACCCCACCCAGG + Exonic
1185509132 X:649784-649806 TCCCTCCTCTCCCCAAAACTTGG + Intronic
1186477545 X:9869472-9869494 TCCCTCCTCTCCCCAGCCCCTGG + Intronic
1186777673 X:12882010-12882032 CTCCTCCTCTTCCCACAGCCCGG - Intronic
1187329531 X:18324303-18324325 TCACTCATCTGCCCACTTCCAGG + Intronic
1190117574 X:47636393-47636415 TCCCTCATCTCCCCAAGGGCAGG + Exonic
1190189674 X:48266836-48266858 TCCCTCTTCTCGCCTCAGCCTGG + Exonic
1190215375 X:48476460-48476482 TCCCTCCTTTCCCCGCAGGCGGG - Intronic
1190258933 X:48786175-48786197 TCCCTTCTCTCCCTGCAGCCAGG + Intergenic
1190658434 X:52633340-52633362 TCTCTCTTCTCGCCTCAGCCTGG + Intergenic
1192210913 X:69127170-69127192 TCCCTCCCCTCTCCACTGCCAGG + Intergenic
1192264771 X:69530693-69530715 TCGCCCATCTCCCCAAAGCCGGG - Exonic
1192844557 X:74892428-74892450 TCCTCATTCTCCCCACAGCCTGG + Intronic
1197177564 X:123501629-123501651 TACCTTATCTCCCACCAGCCAGG + Intergenic
1197185770 X:123585837-123585859 TCCCTCATTTCCCCAGACCTAGG + Intergenic
1197775779 X:130117904-130117926 TAGCTGATCTCCCCACAGCCCGG + Intergenic
1198102735 X:133436144-133436166 ACCCCCATCTCCTCACTGCCTGG - Intergenic
1199500533 X:148501314-148501336 TCCCGCACCTCCCCCCACCCCGG - Intronic
1201463071 Y:14249641-14249663 TCCCTCTCCTCCCTACAGTCAGG - Intergenic