ID: 1172962314

View in Genome Browser
Species Human (GRCh38)
Location 20:38807388-38807410
Sequence GAACACTCCTTGGCCAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172962306_1172962314 28 Left 1172962306 20:38807337-38807359 CCAGGCTGTGGGGAGATGAGGGA 0: 1
1: 1
2: 8
3: 57
4: 504
Right 1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172962314 Original CRISPR GAACACTCCTTGGCCAATAC TGG Intronic
901153765 1:7122067-7122089 GAACACTCCATGGCCTTTCCCGG - Intronic
902998174 1:20243777-20243799 GAACACTTCTTGGCAATTAAGGG - Intergenic
907762626 1:57376530-57376552 GAACAATCCCTGGCAAATATCGG + Intronic
913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG + Intergenic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
922995068 1:229950489-229950511 GAATACTACTTGGCCATTAAAGG - Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1067547423 10:47203937-47203959 AATGACTCCTTGGCCAATTCCGG - Intergenic
1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079449693 11:20589251-20589273 GAACAATCCTCAGCCAATAAGGG + Intergenic
1080178428 11:29394518-29394540 GAACACTCCTTGAATAATGCAGG + Intergenic
1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG + Intergenic
1083179765 11:60977571-60977593 GATGACACCTTGGCCAACACTGG - Intronic
1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG + Intergenic
1090502420 11:127274519-127274541 GAACAAGACTTGGCAAATACTGG + Intergenic
1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG + Intronic
1098126985 12:67307271-67307293 GAATTCTCCTTGGCCAAGAAGGG - Intronic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1112241263 13:97683859-97683881 CAAGACACCGTGGCCAATACGGG - Intergenic
1115573500 14:34689164-34689186 GTATAATCCTTGGCCAATAATGG - Intergenic
1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG + Intronic
1120544759 14:85797344-85797366 GAACAGTCCTTTGAAAATACAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124199466 15:27665949-27665971 GATCTCTCCTTGGCCAGTCCGGG - Intergenic
1125337577 15:38642296-38642318 TAACTCTCCTTTGCCAATAGAGG - Intergenic
1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG + Intergenic
1129402860 15:75294389-75294411 GAACCCTCCCTGGCCACTCCTGG - Exonic
1130843018 15:87719415-87719437 GAACTCTGGTTGGCCAGTACAGG - Intergenic
1132411487 15:101581465-101581487 GAACACTCCTAGACCATGACAGG - Intergenic
1133895648 16:9926123-9926145 GAACTCTCCTTGGGTAATTCAGG + Intronic
1139209208 16:65059741-65059763 AAACACGCCTTGTCCAATGCCGG + Intronic
1150265394 17:63829270-63829292 GAAGGCTGCTTGTCCAATACTGG - Intronic
1155744140 18:29330368-29330390 TTACTCTCCTTGGCCAATGCAGG + Intergenic
1161295918 19:3520157-3520179 GACCACTCCTGGGCCAGCACTGG - Intronic
1162520291 19:11175680-11175702 GAACACTCACTGGCCAAGCCTGG - Intronic
1164270797 19:23670002-23670024 GAAAACTTCTTGGCCCAGACTGG - Intronic
1164478872 19:28596246-28596268 TAACCCTCCTTGGTCAGTACTGG - Intergenic
925531791 2:4871561-4871583 GAACACTTCTTTCCCAATGCAGG + Intergenic
927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG + Intergenic
940951953 2:159685651-159685673 GAACTCCCCATGGCCAATGCTGG + Intergenic
942221618 2:173774669-173774691 GGACACTCCTTGCCCAATTTTGG - Intergenic
944103752 2:196056563-196056585 GAACAATCTTTCACCAATACAGG + Intronic
945598312 2:211824038-211824060 GAACACTCCATGCCCAAGCCTGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173374512 20:42471458-42471480 GAACACTACGTGGCCAAAGCAGG - Intronic
1173945109 20:46944216-46944238 GAGCACTGGTTGGCCAAAACAGG - Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
952157140 3:30655699-30655721 CAGCACTACTTGGCCAATAATGG - Intronic
953576198 3:44114831-44114853 GAACTCTCCCTGGCCAAGAAAGG - Intergenic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
955107161 3:55909268-55909290 GAACATTCCTTGGCCACATCAGG + Intronic
958201444 3:90321582-90321604 GAACACTTTTTGGCCAGTATTGG - Intergenic
960932867 3:122872430-122872452 GAACACTCCCAGGAGAATACAGG - Exonic
964440391 3:156702553-156702575 TAACACTCATTGGCACATACTGG - Intronic
973859704 4:55050789-55050811 GAACACACCATGGCAAATTCAGG - Intergenic
977830612 4:101587713-101587735 GACTACTCACTGGCCAATACTGG - Intronic
982046671 4:151454336-151454358 GAACAGTCTTTGGCCCAAACAGG - Intronic
984576449 4:181453813-181453835 GAACTCCCCTTGGCCAGCACAGG + Intergenic
992825997 5:80550753-80550775 AAACACTCCTTGCCCCAGACGGG - Intergenic
997640190 5:135443844-135443866 CAGCACTCCTGGGCCATTACTGG - Intergenic
1001008664 5:168077358-168077380 GAACAGTGCTTGGCCCATAGTGG - Intronic
1002177480 5:177409432-177409454 GAACAATCCTGGGACAATCCTGG + Intronic
1007116733 6:39348346-39348368 GATCACACCGTGGCCAATAGGGG + Intronic
1008427328 6:51374584-51374606 GAATACTTATTGGCCAATAAAGG + Intergenic
1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG + Intergenic
1016224182 6:141714477-141714499 GAACTGTCCTAGGCCAAAACAGG - Intergenic
1020571472 7:9868831-9868853 GAACCCCCATTGGCCAAAACTGG + Intergenic
1023454920 7:40328362-40328384 GAACAGTCCTTGAGCAATATAGG + Intronic
1023476904 7:40590289-40590311 GAACACTTCAAGGCCAATATAGG - Intronic
1028103614 7:86851190-86851212 GAACACACCTTGGAAAATGCTGG + Intronic
1029794338 7:102877989-102878011 GAACACCCCTTGGGAAATGCTGG + Intronic
1035740365 8:1923616-1923638 GAAACCTTCTTGGCCAATGCTGG + Intronic
1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG + Intergenic
1044987899 8:97771145-97771167 GAACTCTCCTTGTCCATTACTGG - Intergenic
1045989962 8:108295489-108295511 GGTTACTCCTGGGCCAATACTGG - Intronic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1053519698 9:38765122-38765144 CAACACTCCTTGGGCACCACTGG + Intergenic
1057856070 9:98601744-98601766 GACCAGCCCTTGGCCCATACTGG - Intronic
1059743365 9:117177216-117177238 AGACACTCCTTGGCCTATACAGG - Intronic
1186304077 X:8235272-8235294 GAACACTCAGAGGCCATTACAGG + Intergenic
1188528777 X:31114605-31114627 GAAATCGCCTGGGCCAATACTGG - Intronic
1192880191 X:75274928-75274950 GACAACTCCTTGGCCATTCCAGG + Intronic
1193540013 X:82759710-82759732 GACCAATCCTTGGCCAAGCCAGG + Intergenic