ID: 1172962697

View in Genome Browser
Species Human (GRCh38)
Location 20:38809676-38809698
Sequence TGTGGATAAAAAACCTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172962694_1172962697 13 Left 1172962694 20:38809640-38809662 CCCTAAGATGATGATGTGAGGAG 0: 1
1: 0
2: 2
3: 55
4: 389
Right 1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172962692_1172962697 16 Left 1172962692 20:38809637-38809659 CCTCCCTAAGATGATGATGTGAG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172962691_1172962697 19 Left 1172962691 20:38809634-38809656 CCACCTCCCTAAGATGATGATGT 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1172962695_1172962697 12 Left 1172962695 20:38809641-38809663 CCTAAGATGATGATGTGAGGAGA 0: 1
1: 0
2: 4
3: 71
4: 493
Right 1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172962697 Original CRISPR TGTGGATAAAAAACCTAGCT TGG Intronic
903463471 1:23535422-23535444 TGTATGTAAAATACCTAGCTGGG - Intergenic
905056596 1:35100049-35100071 TGAAAATAAAAAAACTAGCTGGG - Intronic
906309449 1:44742779-44742801 TGTGCATGCAGAACCTAGCTTGG - Intronic
906733635 1:48104239-48104261 TGTTCATAAAAAACCAATCTGGG + Intergenic
910659579 1:89656814-89656836 TTTGAATAAAAAAAATAGCTAGG - Intronic
911641638 1:100295996-100296018 TGTGGGTGAAAAAATTAGCTAGG + Intergenic
913355768 1:117920300-117920322 TGTGGATACACTACCAAGCTGGG - Exonic
913539454 1:119804923-119804945 TATGGATAAAACACCTAACATGG - Intronic
916790497 1:168121002-168121024 TTTGGAAAAAAAACATATCTAGG + Intronic
918258286 1:182770225-182770247 AGTGGATAAATATCCTTGCTGGG + Intergenic
918581590 1:186137147-186137169 TGTGAATCAAAAATCTAGTTTGG - Intronic
918984808 1:191609616-191609638 TGAGAATACAAAAACTAGCTGGG + Intergenic
923293023 1:232565177-232565199 TCTGGATAAAAACCTTAGATAGG + Intergenic
924013753 1:239696941-239696963 TGGTGATAAAAAACCAACCTTGG - Intronic
924120625 1:240794305-240794327 TGTGGTTAAAAAAGACAGCTTGG - Intronic
1063225487 10:4011725-4011747 TATGGATAAAAAGCCTGGCAAGG + Intergenic
1064258287 10:13764220-13764242 TATGGTAAAAACACCTAGCTGGG + Intronic
1069375873 10:67792151-67792173 TGTGGTTCCAAAACTTAGCTGGG + Intergenic
1069389450 10:67917998-67918020 TATGCATAAAACACCCAGCTAGG + Exonic
1074378434 10:112958142-112958164 TAAGGAGAAAAAACCTATCTTGG - Intronic
1078412341 11:11136185-11136207 TGTTGAGAAAACACCTAACTTGG + Intergenic
1078447508 11:11415574-11415596 TGTGGGCACAAACCCTAGCTTGG + Intronic
1080396258 11:31893041-31893063 TGAGGATAAACAAAGTAGCTTGG - Intronic
1080521918 11:33075145-33075167 TGTGGATGAAAAAGCTTTCTGGG - Intronic
1082637495 11:55614287-55614309 TGTGGATAAAATAACTTACTGGG + Intergenic
1083689284 11:64397015-64397037 TATGTTTAAAAAACTTAGCTGGG - Intergenic
1084030375 11:66477464-66477486 TGTGGATTCAAATCCTGGCTTGG - Intergenic
1085039462 11:73318250-73318272 TGTGGAAAAAGACCCTATCTGGG - Intronic
1085145920 11:74197247-74197269 TGTGCATAAAGCACTTAGCTGGG - Intronic
1092835916 12:12488090-12488112 TGTGGATAAAGCACCCAGCTTGG - Intronic
1093824543 12:23667569-23667591 TGAGGAAATAAGACCTAGCTTGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1098825056 12:75286117-75286139 TGTAGATAAAATACCTAACAAGG + Intronic
1101384365 12:104243141-104243163 TAAGGCTAAAAAACCTACCTAGG + Intronic
1101428178 12:104604943-104604965 TGGGGATATAAAACCTAGCTTGG - Intronic
1101996327 12:109527815-109527837 TGTGTATAAAATACCTTCCTGGG + Intronic
1102069808 12:110008881-110008903 TCTGGAAAAAAAACCCATCTGGG + Intronic
1106233250 13:27839121-27839143 TGTCTACAAAAAACCTTGCTAGG + Intergenic
1109208069 13:59503976-59503998 TGTGGGTAAAAGACCATGCTTGG + Intergenic
1111440504 13:88277438-88277460 TGTTAATAAAAAACATATCTAGG + Intergenic
1111818322 13:93182950-93182972 TTAGGATTAAATACCTAGCTAGG - Intergenic
1113494651 13:110716907-110716929 TGTTGATAAAATACTTTGCTTGG + Intronic
1116391197 14:44391860-44391882 TGTGCATGAGAAACCTACCTTGG + Intergenic
1120836964 14:89048271-89048293 TATGGAAAAAAAAATTAGCTGGG - Intergenic
1123180393 14:106464233-106464255 TATGGATAAAAGACTTAACTGGG + Intergenic
1202946502 14_KI270726v1_random:32429-32451 TATGGATAAAAGACTTAACTGGG - Intergenic
1123476196 15:20593846-20593868 TGTCCATAAACAACCTTGCTGGG + Intergenic
1123641816 15:22406518-22406540 TGTCCATAAACAACCTTGCTGGG - Intergenic
1123787816 15:23690191-23690213 TGGGGATAATAAATCTTGCTGGG + Intergenic
1124106943 15:26747254-26747276 TGTGTACAAAAATCCTTGCTGGG + Intronic
1126338513 15:47613813-47613835 TATGTATAAAAAAATTAGCTGGG - Intronic
1126556268 15:49991180-49991202 TTTGGTTAAAAAAAATAGCTTGG - Intronic
1126853098 15:52810622-52810644 TGTGGAAAAAAAAATTAGCCAGG - Intergenic
1130526253 15:84709323-84709345 TGGGGATAAAAATGATAGCTAGG - Intronic
1135779626 16:25289021-25289043 TGTGTAGAAAATACCTAGCATGG + Intergenic
1137284720 16:47005716-47005738 TGTTTTTAAAAAACCTATCTGGG - Intergenic
1138647532 16:58435946-58435968 TGTGCATGTAAAACCCAGCTAGG + Intergenic
1140312702 16:73865049-73865071 TGTGCATAAAGAAGCTAGCCTGG - Intergenic
1140382439 16:74502353-74502375 TGTGGAAGAAGAAACTAGCTAGG + Intronic
1142493262 17:292434-292456 TCTGCATAAAACAGCTAGCTTGG - Intronic
1146482129 17:33213267-33213289 GGTGGAAAAAAAACCTTGCTTGG + Intronic
1150372257 17:64649963-64649985 TTTGGATTGAAATCCTAGCTAGG - Intronic
1152028315 17:77825960-77825982 GGTCGGTAAAATACCTAGCTTGG - Intergenic
1152996826 18:415305-415327 TGAGGATAGAAAATCTAGGTAGG - Intronic
1153281493 18:3418591-3418613 TGTGGATAGAAAATGTAGTTAGG - Intronic
1154007332 18:10543477-10543499 TGATGATAATAAACTTAGCTGGG + Intronic
1154237014 18:12615377-12615399 TGTATATAAAAAAAATAGCTAGG + Intronic
1155009192 18:21758150-21758172 TGTGTGTAAAGAACCAAGCTTGG + Intronic
1156116930 18:33796700-33796722 AGTGTATAAAAGACCAAGCTTGG - Intergenic
1156700796 18:39821965-39821987 GATGGAAAAAAAACCTAGATAGG - Intergenic
1158572868 18:58611747-58611769 TGTAGATAAAAAACACAGCGGGG + Exonic
1159329187 18:66967223-66967245 TGTGTATAGAAAACCTATTTAGG - Intergenic
1159737662 18:72121566-72121588 TGTGGATAGAAAATGTAGTTAGG - Intergenic
1165084849 19:33337305-33337327 TGTGAATAAAAAATCTGGCCTGG + Intergenic
927581507 2:24254388-24254410 TGTAAATAAGAAACCTACCTCGG - Exonic
930668672 2:54124906-54124928 TATGAATACAAAACGTAGCTGGG - Intronic
932150778 2:69369607-69369629 TTTGGATTAAATGCCTAGCTTGG - Intronic
935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG + Intergenic
937660242 2:124422634-124422656 TGTGAATAAAAAAAGTATCTGGG - Intronic
942832032 2:180248481-180248503 TGTGAATAAAACACTCAGCTTGG + Intergenic
943342967 2:186703326-186703348 TGTGGATCCAAATGCTAGCTGGG + Intronic
944478244 2:200128494-200128516 TGAGGTTATAAAACCTGGCTTGG - Intergenic
944670457 2:201990002-201990024 TATAAATAAAAAACCCAGCTGGG - Intergenic
945795534 2:214358262-214358284 TGGGGAAAGAAAACCAAGCTTGG - Intronic
946289604 2:218734242-218734264 TATGGATAAAATGCCTAGCATGG + Intronic
947242766 2:228014212-228014234 TTTGGTTAAAAATCTTAGCTGGG + Intronic
949055722 2:241927405-241927427 CATGAATAAAAAACCTTGCTGGG + Intergenic
1168932899 20:1638260-1638282 AGTGGATAAAAAACCCACCCTGG + Intronic
1169497506 20:6129398-6129420 TGTTTAAATAAAACCTAGCTGGG - Intergenic
1172962697 20:38809676-38809698 TGTGGATAAAAAACCTAGCTTGG + Intronic
1177672013 21:24244672-24244694 TGAAGATACAAAACTTAGCTGGG + Intergenic
1177850713 21:26344499-26344521 TATGCATAAAATACCCAGCTAGG + Intergenic
1179512186 21:41880268-41880290 TGTCTCTAAAAAACTTAGCTGGG + Intergenic
1180858684 22:19064401-19064423 TGTGGAGTCAAAACCCAGCTTGG + Intronic
1183135622 22:35884370-35884392 TGTGGATCAGAAATCCAGCTGGG + Intronic
1184173025 22:42770498-42770520 TGGGGAAAAAAAAATTAGCTGGG - Intergenic
953043066 3:39272092-39272114 TGTGGATATGAAACCCAGCTGGG - Intronic
955490168 3:59473824-59473846 TGTGGTTAAAAAACATTTCTCGG + Intergenic
957363225 3:79186129-79186151 TGTGGATAGAATACAGAGCTTGG - Intronic
957592214 3:82214232-82214254 TGAGGACAAAAAACCGAGGTGGG + Intergenic
957604949 3:82386273-82386295 TGTGGATCAAAAATGTACCTAGG - Intergenic
958427807 3:93999399-93999421 TGTGAATAAAAAAATTAGCTAGG - Intronic
959447506 3:106458468-106458490 TGTGAATAAAGAACCTATCTTGG + Intergenic
961608965 3:128121413-128121435 AATAGATAAAAAACCTAGCCAGG + Intronic
963600235 3:147372219-147372241 AGTGGTTAAAAAACTTTGCTGGG - Intergenic
965318540 3:167222456-167222478 TGTGGACAAAAAAAATAGTTAGG + Intergenic
965911721 3:173786123-173786145 TGTGCATAAAAAAAATACCTAGG - Intronic
966087344 3:176084654-176084676 TATGGACAAAATACCTATCTTGG - Intergenic
971903424 4:32694532-32694554 TGTGTTTACAAAACATAGCTGGG + Intergenic
977208756 4:94193818-94193840 AATAGAAAAAAAACCTAGCTGGG - Intergenic
977708001 4:100092950-100092972 TGTGTATATAAATCCTTGCTGGG + Intergenic
978020620 4:103806676-103806698 TTTGAAAAAAAAATCTAGCTTGG - Intergenic
978407569 4:108396166-108396188 TGTGGATATAAAACCTACCCAGG + Intergenic
978907411 4:114023700-114023722 TGGGGATAAAAAACCTAGAATGG - Intergenic
979495971 4:121382712-121382734 TGTCTACAAAAAACCTTGCTGGG + Intergenic
980694612 4:136338390-136338412 TCTGGATAAGAACCCTTGCTAGG - Intergenic
980759825 4:137216589-137216611 TGGGGAAAAAAAACCAATCTTGG - Intergenic
981458838 4:144988470-144988492 TGTGAATAAAAAACCAAGATTGG - Intronic
986968900 5:13308609-13308631 TGTGCATAGAAAAACAAGCTGGG + Intergenic
988109381 5:26798581-26798603 TGTTAATAAAAAACTTGGCTGGG + Intergenic
992174598 5:74137235-74137257 TATGGATTCAAAAGCTAGCTTGG - Intergenic
995142070 5:108746044-108746066 TGTGGACATCAAACCTAGGTGGG - Intergenic
996429063 5:123350422-123350444 TGTTTAGAGAAAACCTAGCTGGG - Intronic
997158862 5:131586250-131586272 TCTGAATAAGAAACCTTGCTTGG - Intronic
1002889117 6:1317986-1318008 TATGGATAAAGAACCTAACCAGG + Intergenic
1002900849 6:1408453-1408475 TGTGGAAAAAAAGCATAGCATGG + Intergenic
1003577497 6:7311360-7311382 TGTGGATAAAAAACATGGGAAGG + Intronic
1008345318 6:50419687-50419709 TTTAGATGAAAAAGCTAGCTTGG + Intergenic
1009612015 6:65957117-65957139 TGTGCATTTAAATCCTAGCTGGG + Intergenic
1009806923 6:68611250-68611272 TGTTGATAAAAATTCAAGCTGGG + Intergenic
1010047038 6:71457080-71457102 TGTATATATAAAACTTAGCTGGG - Intergenic
1010878027 6:81132880-81132902 AGTGAATAAAATAGCTAGCTAGG - Intergenic
1011593264 6:88991589-88991611 TGTGGATAAAGCACTTAGCTTGG + Intergenic
1013952696 6:115803883-115803905 TTTGCATAAAATACCTAGCCTGG + Intergenic
1015858940 6:137655646-137655668 TGTGGATATAAAACCATGGTTGG + Intergenic
1018096796 6:160394662-160394684 TCTGGTTAAAATACCTAGCCTGG - Intronic
1020441266 7:8219212-8219234 TTTGGATAAAATACTTATCTTGG + Intronic
1022963485 7:35452157-35452179 TGTTGATAAAAATGCAAGCTGGG - Intergenic
1023408964 7:39868767-39868789 TGTTGTAAAAAAATCTAGCTGGG + Intergenic
1023758096 7:43439151-43439173 TGTACATAAAGAACCTAGCACGG + Intronic
1024715478 7:52075065-52075087 AGTGTATAAAAAACCTAGAGTGG + Intergenic
1025043973 7:55675272-55675294 TGTAGTAAAAAAATCTAGCTGGG - Intergenic
1025140047 7:56455353-56455375 TTTGCATAAAAACCCTAACTCGG - Intergenic
1025755834 7:64339725-64339747 TGAGGATTAAAAACAAAGCTAGG - Intronic
1028429265 7:90728573-90728595 TGAGGATACAAAATGTAGCTTGG + Intronic
1028492187 7:91424691-91424713 TGTGGAAAAAAATCCTGGCTTGG - Intergenic
1029576240 7:101405489-101405511 TGGGGAAAAAAAAATTAGCTGGG - Intronic
1031252671 7:119407762-119407784 TGTGGAGAATAAAACTTGCTAGG - Intergenic
1031367728 7:120923874-120923896 TAAGAATAAAAAAGCTAGCTGGG + Intergenic
1037104559 8:15090731-15090753 AGTCGATAAAACACCTAGTTTGG + Intronic
1038938370 8:32277490-32277512 TTTAGGTAAAAAACTTAGCTAGG - Intronic
1041114401 8:54520759-54520781 TGTAGAGAAAAAACATTGCTAGG + Intergenic
1041696014 8:60736834-60736856 TGTGGACTAGAAACCTAGCAAGG - Intronic
1041788227 8:61659715-61659737 TTTTCATGAAAAACCTAGCTTGG - Intronic
1044195420 8:89371732-89371754 TGTTTATAAAAATCCTAGCTGGG + Intergenic
1044274138 8:90280622-90280644 TATGGAAAAAAAAATTAGCTGGG - Intergenic
1044716301 8:95102871-95102893 TGTTGAGCAAAAATCTAGCTGGG - Intronic
1045244804 8:100433774-100433796 TGTAGACAAGAAACATAGCTGGG + Intergenic
1045339768 8:101243068-101243090 TGTGAAGAAAAAATATAGCTTGG - Intergenic
1047180766 8:122585570-122585592 TCTTGATAAACATCCTAGCTAGG - Intergenic
1050703114 9:8363780-8363802 TTTGGATACAAAACATAGCTGGG - Intronic
1052114825 9:24637630-24637652 TGAAAATACAAAACCTAGCTGGG - Intergenic
1057611502 9:96547612-96547634 TGGGGAAAAAAAAATTAGCTGGG - Intronic
1057784640 9:98077555-98077577 AGTATATATAAAACCTAGCTGGG + Intronic
1058298750 9:103342905-103342927 TGTGGATAGAAAAGCGAGTTTGG - Intergenic
1058607028 9:106733982-106734004 TGTGGATATAAAGCCAAACTTGG + Intergenic
1059000159 9:110340415-110340437 TGTGGTTAAGAAACCCTGCTTGG - Intergenic
1061956182 9:133962393-133962415 TCTGGATAGAAAGCCTACCTTGG - Intronic
1062303597 9:135889548-135889570 TGTGGAGAAAAGACCAAGCCCGG + Intronic
1062557732 9:137123082-137123104 TGTGGAAAAAACACGCAGCTGGG + Intergenic
1188194754 X:27219455-27219477 TGTCAATAAAAAACCCTGCTTGG + Intergenic
1189319547 X:40079454-40079476 GGTGGACAAAAGACCTAGTTAGG - Intronic
1192588727 X:72341713-72341735 TGTGAATAAAAATCTTGGCTTGG + Intronic
1193629183 X:83860486-83860508 TATAGATAAAAAACCTTTCTGGG - Intergenic
1194645407 X:96453170-96453192 TATAGTTAAAAAACCTTGCTAGG + Intergenic
1194710689 X:97232830-97232852 TGAGGAGAACAAACCTAGTTTGG - Intronic
1195382826 X:104286954-104286976 TTTGCATAAAAAAATTAGCTAGG + Intergenic
1196096998 X:111810694-111810716 TGTGAATATAATACCTAGTTGGG + Intronic
1196550904 X:117023617-117023639 TGAGGATCAAAAAACTACCTGGG - Intergenic
1200897082 Y:8387202-8387224 TTTGGGGAAAAAACCTAGGTGGG + Intergenic