ID: 1172965801

View in Genome Browser
Species Human (GRCh38)
Location 20:38833893-38833915
Sequence CTGTAGAAAGGGCTTTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172965793_1172965801 12 Left 1172965793 20:38833858-38833880 CCTGAGGATTTAGCCTGAGCCCT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216
1172965792_1172965801 24 Left 1172965792 20:38833846-38833868 CCAATCTGAGCACCTGAGGATTT 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216
1172965795_1172965801 -7 Left 1172965795 20:38833877-38833899 CCCTGCTCTTCAGCTTCTGTAGA 0: 1
1: 0
2: 2
3: 18
4: 272
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216
1172965791_1172965801 25 Left 1172965791 20:38833845-38833867 CCCAATCTGAGCACCTGAGGATT 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216
1172965796_1172965801 -8 Left 1172965796 20:38833878-38833900 CCTGCTCTTCAGCTTCTGTAGAA 0: 1
1: 0
2: 2
3: 11
4: 240
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216
1172965794_1172965801 -1 Left 1172965794 20:38833871-38833893 CCTGAGCCCTGCTCTTCAGCTTC 0: 1
1: 0
2: 2
3: 48
4: 397
Right 1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172965801 Original CRISPR CTGTAGAAAGGGCTTTTGGA GGG Intronic
902815309 1:18913237-18913259 CTGTGGGAATGGCTTTTGGAGGG - Intronic
903604189 1:24562921-24562943 CTGGAGAAAGGGCATAAGGAGGG - Intronic
904771599 1:32884354-32884376 CAGTAGATAGGGGTTTTGGAAGG - Intergenic
905647661 1:39635613-39635635 CTGTAATATGGGCTTTTGTAAGG - Intronic
906038053 1:42765379-42765401 CTGTAGTAAGGGCTACTGCAAGG - Intronic
907085499 1:51668895-51668917 CTGTGAAAAGTGCTCTTGGAGGG + Intronic
907740738 1:57163328-57163350 CTGTAGAAATGACATTTGAAAGG + Intronic
907880312 1:58543823-58543845 TTGTAGAAAGGTCTGTTGTATGG - Intronic
908193370 1:61725677-61725699 CTTTAGAGAAGGATTTTGGAAGG + Intergenic
909842293 1:80343522-80343544 ATTGAGAGAGGGCTTTTGGATGG + Intergenic
911161113 1:94683964-94683986 CTGCAGAAAGGGCTCTGGGCCGG + Intergenic
911581708 1:99641776-99641798 CTGTAGAAAGAGCCTGTAGAAGG - Intergenic
913220781 1:116658704-116658726 ATCTGGAAAGGCCTTTTGGAAGG - Intronic
913320659 1:117586229-117586251 CTATAGAAAGGTCTGTTGGCTGG + Intergenic
914651966 1:149704283-149704305 CTGGAGATAGGGCTTTTCCAAGG + Exonic
917511455 1:175672552-175672574 CTGCAGAAACTGCCTTTGGATGG - Intronic
917829495 1:178864980-178865002 ATCTTGAAAGGGCTTTTGGTGGG + Exonic
923427619 1:233887697-233887719 CTGTAGAGAAGGCTTTGGAATGG + Intergenic
1063007950 10:1992727-1992749 CCGCAGACAGGCCTTTTGGAGGG - Intergenic
1063838953 10:10048255-10048277 TTGGAGATAGGGCCTTTGGAAGG + Intergenic
1065229780 10:23586063-23586085 CTGCAGAAAAGTCTCTTGGATGG - Intergenic
1069694197 10:70374763-70374785 CTGTAGAAAGTGCATTTGCAAGG + Intronic
1071852039 10:89583132-89583154 TTGTTGAAAGGGATTTTTGAAGG - Exonic
1073062765 10:100742179-100742201 CAGGAGAAAGGGTTTCTGGAAGG + Intronic
1073527331 10:104196440-104196462 GTGCTGAAAGGTCTTTTGGAGGG - Intronic
1075625624 10:123962732-123962754 CTGGAGAGAGGGCTTTTGTTGGG - Intergenic
1075966022 10:126612408-126612430 TTGTAGAAAGTTCTATTGGATGG + Intronic
1076832246 10:133001549-133001571 CTGCTGAAAGGGCTGTTTGACGG + Intergenic
1079118083 11:17653430-17653452 ATAGAGACAGGGCTTTTGGAAGG - Intergenic
1081232552 11:40603640-40603662 ATGTAGAAAAGGCTTCTGAATGG + Intronic
1084484921 11:69442690-69442712 GTCTAGAAAGTGCTTTTGCAAGG - Intergenic
1084689324 11:70715963-70715985 CTGTGGACAGGGCGTCTGGAGGG + Intronic
1085332573 11:75666444-75666466 CTGGAGAAAGGGGTTTTTGGTGG + Intronic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1091642262 12:2246373-2246395 CTGTAGTAAGGCCTTTTAGATGG + Intronic
1092289998 12:7154435-7154457 CTGTAAAAGGGATTTTTGGATGG + Intronic
1092838468 12:12515248-12515270 ATCTAGGATGGGCTTTTGGAAGG - Intronic
1093465530 12:19444751-19444773 TTGTAGAATGGTATTTTGGAGGG + Intronic
1094408334 12:30143267-30143289 TTGTAGATGGGGCTTTTGGAAGG + Intergenic
1095526389 12:43130770-43130792 CTTTAGAAATGCCTTTTTGATGG + Intergenic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097908703 12:64946685-64946707 CTGTATGAAGGGCCTTTGGCAGG - Intergenic
1098308973 12:69129369-69129391 CTTTAGTAAGCGTTTTTGGAGGG + Intergenic
1100076514 12:90791564-90791586 CTGAAGAAAGGGTTTTTGAATGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1105448566 13:20478437-20478459 CTGTACAGAGCTCTTTTGGAAGG - Intronic
1105825289 13:24116795-24116817 TTGGAGAAAGGGCCTTTGGGAGG + Intronic
1105870717 13:24503996-24504018 CTGTACAAAGGGATTTTTGGTGG - Intronic
1106957519 13:34956945-34956967 CTGTAGAAATTACTTTTGGCTGG - Intronic
1107817997 13:44261530-44261552 CTGTGGAAAGAGCCTTTGGAGGG + Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1109817164 13:67599659-67599681 TTATAGATAGGGCTTTTGGGAGG + Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1110959346 13:81601535-81601557 TTGGAGATACGGCTTTTGGAAGG + Intergenic
1111949003 13:94694951-94694973 CTGAAGAAAGTGTTTCTGGAAGG + Intergenic
1113038507 13:106078247-106078269 CTGTAGAATGTGCCTTAGGATGG - Intergenic
1113501079 13:110774729-110774751 CTGGAGGTAGGGCCTTTGGAAGG - Intergenic
1116458966 14:45148973-45148995 CTGGATATAGGTCTTTTGGATGG - Exonic
1117221982 14:53615667-53615689 CTGCAGAAAGTTCTATTGGATGG - Intergenic
1119322055 14:73738099-73738121 CTATAGAAAGTGCTTCTGGCTGG + Intronic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1122760917 14:104025511-104025533 ATCTAGAAAGGACTTTTGTAAGG - Intronic
1123076772 14:105671398-105671420 GTGAAGAAAGGGATTTGGGAGGG - Intergenic
1123135017 14:106019866-106019888 GGGTATAAAGCGCTTTTGGACGG - Intergenic
1123841423 15:24251665-24251687 CTCTAGAAAGGGCATAAGGATGG - Intergenic
1125229917 15:37442044-37442066 CTCTAAAATGGGTTTTTGGAAGG - Intergenic
1126252268 15:46582305-46582327 CTATTGAAAGGTCTTTTTGATGG + Intergenic
1127340848 15:58042255-58042277 CTGTATGAAGGGATTTAGGAAGG - Intronic
1127469060 15:59274189-59274211 CTCTGGAAAGGGATTCTGGAAGG + Intronic
1128381284 15:67114859-67114881 GTGCAGAGAGTGCTTTTGGAGGG - Intronic
1129048817 15:72760888-72760910 TTGGAGATAGGGCTTTTGGAAGG + Intronic
1130018949 15:80210981-80211003 CTGAAGATAGGGCTTTTAGGAGG - Intergenic
1135684057 16:24483622-24483644 GTGGAGAAAGGGCCTTTGGGAGG - Intergenic
1136414574 16:30095701-30095723 CTGGAGGAAGGGGCTTTGGAGGG + Exonic
1137010954 16:35319532-35319554 CTCTGGATAGGGCTTTTGGGAGG + Intergenic
1137036205 16:35572107-35572129 CTGTGGGAAGGGCTTTAGTAGGG + Intergenic
1140870368 16:79100968-79100990 CTGTAGAAAGGTCTTGTGGTGGG + Intronic
1140954426 16:79849158-79849180 GTGGTGAAAGGGCCTTTGGAGGG - Intergenic
1141093304 16:81145372-81145394 CTGTAGAAAGTTCTATTGGATGG + Intergenic
1142030409 16:87835768-87835790 CTGTTGAACGGGCTTTAGGCTGG - Intronic
1203071601 16_KI270728v1_random:1081866-1081888 ATGTATAATGGGTTTTTGGAAGG + Intergenic
1145018114 17:19411947-19411969 CTGTAGCATGGGGTTGTGGAGGG + Intronic
1146190250 17:30759110-30759132 CTTTAAAAAGGAATTTTGGAGGG - Intergenic
1146335419 17:31965763-31965785 CTTTAAAAAGGAATTTTGGAGGG - Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1149397929 17:56263856-56263878 CTGTTGAAAGTCCTTTGGGATGG - Intronic
1150049331 17:61944874-61944896 CTGTAGAAAGGATTTTTCAAGGG + Exonic
1151322106 17:73358561-73358583 CTCTATAAGGGCCTTTTGGAAGG + Intronic
1152177923 17:78800148-78800170 CTGGTTAAAGGGGTTTTGGAGGG - Intronic
1153739787 18:8111871-8111893 CTCTTGAAATCGCTTTTGGAGGG - Intronic
1153934952 18:9913553-9913575 CTGTAGTAACGGCTGTTTGAGGG - Intergenic
1154341123 18:13503311-13503333 CTGTAGAAAAGGATTTTCAAAGG - Intronic
1156891745 18:42198222-42198244 ATGTGGGAAGGGCTTTTGAAAGG + Intergenic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1162178994 19:8854078-8854100 CTGCAGAAAGTTCTATTGGATGG + Intronic
1164079480 19:21850260-21850282 CTGTAGAAAGGGCCTGGGCAGGG + Intronic
1164841887 19:31398906-31398928 CACGAGAAAGGGCATTTGGAAGG + Intergenic
1165217636 19:34287854-34287876 CTGGAGGTAGGGCCTTTGGAAGG - Intronic
1166978503 19:46619194-46619216 CTGTAGAAAGGACTTATTGCTGG + Intergenic
1167027087 19:46928405-46928427 CTGTAGAAAATCCATTTGGAAGG - Intronic
1167687889 19:50968042-50968064 GTGGGGAAAGGGCATTTGGATGG - Intronic
927105059 2:19817106-19817128 CCCTAGAAAGGGCTTCTTGAAGG - Intergenic
927405972 2:22767183-22767205 TTGGAGACAGGGCCTTTGGAAGG - Intergenic
927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG + Exonic
928110712 2:28506672-28506694 CTGTAGAAAGTTCTTTAGCAGGG + Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929310414 2:40417733-40417755 CAGCAGAAATGGCCTTTGGATGG + Intronic
931939874 2:67240608-67240630 GTGAAGGAAGGGCTTCTGGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933582592 2:84144267-84144289 CTGTAGTTATGGCTTGTGGAAGG - Intergenic
939130052 2:138224218-138224240 CTCAAGAAAGTGCTTTTGGCTGG - Intergenic
940064405 2:149611077-149611099 CCAGAGAGAGGGCTTTTGGATGG + Intergenic
943454830 2:188092688-188092710 CTGGAGAAAGGGGATTTGGTTGG - Intergenic
943798650 2:192030202-192030224 GAGCAGAAATGGCTTTTGGATGG - Intronic
945056073 2:205870088-205870110 CTGCAGAAGGTGCTATTGGATGG - Intergenic
945198952 2:207262650-207262672 TTGTAGAAAGGGCTCTGGGAAGG + Intergenic
946043655 2:216803580-216803602 CTGTAGAAAGGCCTGTAAGATGG - Intergenic
946102002 2:217333368-217333390 TCTCAGAAAGGGCTTTTGGATGG - Intronic
946562022 2:220924653-220924675 ATGCAGAAAGGTCTTTTGGTTGG + Intergenic
947202333 2:227625370-227625392 CTTTAGAAATTGCTTTTGGAAGG + Intronic
947269025 2:228312921-228312943 GTGTAGAAAGGGTTATTGGTGGG - Intergenic
948603668 2:239121480-239121502 CTGTTCCAAGGGCTCTTGGATGG + Intronic
1169153501 20:3308973-3308995 CTGGAGATGGGGCTTTTGGAAGG - Intronic
1169806747 20:9567553-9567575 TTGCAGAAAGGGCTATTGGATGG + Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173184209 20:40828189-40828211 TTGGAGATAGGGCCTTTGGAAGG + Intergenic
1176007202 20:62872454-62872476 CTGCAGAAAAGGCTTCTGGCCGG - Intergenic
1176063575 20:63182763-63182785 CTGTGGAAATGGCTTGTGGTGGG - Intergenic
1176242536 20:64081704-64081726 CTGTAGAAAGCTCTATGGGAAGG - Intronic
1179305733 21:40152558-40152580 CTGGAGAAAGGGCATCTGGGAGG - Intronic
1179505792 21:41839498-41839520 GTGTAGAAAGGCCTCGTGGAAGG - Intronic
1179547574 21:42123005-42123027 CTGCAGGAAGCGCTTCTGGATGG - Exonic
1180822315 22:18838932-18838954 ATCTAGAAAGGCCTTTTGGAAGG - Intergenic
1181190658 22:21137114-21137136 ATCTAGAAAGGCCTTTTGGAAGG + Intergenic
1181208547 22:21273393-21273415 ATCTAGAAAGGCCTTTTGGAAGG - Intergenic
1182752923 22:32656107-32656129 CTTTAGCAAGGGGTTTTGAACGG + Intronic
1183073164 22:35410401-35410423 GTGGAGATGGGGCTTTTGGAGGG + Intronic
1184472598 22:44704219-44704241 CTGTAGGGATGGCATTTGGAGGG + Intronic
1203218385 22_KI270731v1_random:22019-22041 ATCTAGAAAGGCCTTTTGGAAGG + Intergenic
1203272448 22_KI270734v1_random:64817-64839 ATCTAGAAAGGCCTTTTGGAAGG - Intergenic
950761036 3:15226948-15226970 CTCTAGAAAGGGTTTGGGGATGG + Intronic
952694174 3:36246783-36246805 CTCTAGAAAGTGAATTTGGAGGG - Intergenic
953718144 3:45333355-45333377 ATGTAGGAAGGGCTCTGGGAAGG + Intergenic
955343713 3:58145554-58145576 AAGTGGAAAGGGCTTTTGGAAGG - Intronic
956211981 3:66811505-66811527 CTGTAGAAAATACTTTTAGAAGG + Intergenic
956368035 3:68526714-68526736 CTTTAGAAATGGCTCTTTGAAGG - Intronic
956568968 3:70672736-70672758 CTTGAGAGAGAGCTTTTGGAAGG + Intergenic
957181071 3:76878031-76878053 TTGGAGATAGGGCTTTTAGAAGG - Intronic
959178428 3:102947822-102947844 AGGTAGAAAGGGCTTTATGAAGG - Intergenic
962940888 3:140123939-140123961 TTGTAGATAGGGCTTTTAGGAGG - Intronic
969288578 4:6223728-6223750 CTGTAGATAGGGTCTTTAGAAGG - Intergenic
972761517 4:42109984-42110006 GTGTAGACAGTGATTTTGGATGG - Intergenic
974373852 4:61051042-61051064 CTGAAGAAAAGGCATGTGGATGG - Intergenic
975421018 4:74164869-74164891 CAGTAGGCTGGGCTTTTGGAAGG + Intronic
976353481 4:84086965-84086987 CTGGAGCATGGGCTTTTGGCAGG + Intergenic
976662948 4:87559501-87559523 CTGTACAAATGGGGTTTGGATGG + Intergenic
976665207 4:87583316-87583338 CTGAAAAAAGGACTATTGGATGG - Intergenic
979879605 4:125938885-125938907 CTGAGGTAAGGGGTTTTGGAAGG - Intergenic
981634028 4:146854584-146854606 CATTAGAGAGGGCTTATGGAGGG - Intronic
982086222 4:151839463-151839485 CTATAAAAAGAGCTTTTGGGAGG + Intergenic
984981617 4:185287483-185287505 CTGTAGAAAGTTCTACTGGATGG - Intronic
986818249 5:11436221-11436243 CTGTAGAAAGGTCTTTGTAATGG - Intronic
987282525 5:16425663-16425685 CTGTACACAGGTCTTCTGGAAGG + Intergenic
988722085 5:33889432-33889454 CTGTAGGTAGGTCATTTGGAGGG + Intronic
988849552 5:35165523-35165545 CTATTGAAAGGGGTTTTTGATGG + Intronic
989419451 5:41219384-41219406 CTGTTGAGAGAGCTTTGGGAGGG + Intronic
989713663 5:44432411-44432433 ATCTAGAAAGGGCATTTGGTGGG + Intergenic
991049550 5:62257953-62257975 CTTTAGAAAAGGCTTTTGGCTGG - Intergenic
992850348 5:80800990-80801012 CTGTAGAAAGGCCTTAAGGCAGG + Intronic
993907208 5:93636387-93636409 CTGGAGAAGGAGCTTTTGGGAGG + Intronic
995246378 5:109939839-109939861 ATGTAGAAGGGGCGTTGGGAAGG - Intergenic
997053869 5:130416743-130416765 CTGGTGATAGGGCTTTTGCATGG + Intergenic
998461881 5:142315718-142315740 CTGTAAAATGGGCTCTTGCAAGG + Intronic
999024069 5:148205604-148205626 CTGTGGCAAAGGCTTTTGGGAGG + Intronic
999177583 5:149642139-149642161 CTGGACAAAGTGCTTTTGGCTGG - Intergenic
999237390 5:150107140-150107162 CTGAATAAATTGCTTTTGGAGGG - Intronic
1002458270 5:179358468-179358490 CTGGAGACAGGGCTTTTGGGAGG + Intergenic
1002923301 6:1589164-1589186 CTCTAAAATGGGCTTTTGGAAGG - Intergenic
1003069318 6:2932202-2932224 CTGCAGAAATGGCTGTTGCATGG + Intergenic
1004197709 6:13520141-13520163 TTGGAGATAGGGCTTTTAGAAGG - Intergenic
1004791959 6:19036437-19036459 CTAGAGAAAGGGCTTTTGGAAGG + Intergenic
1006511136 6:34521813-34521835 CTGTAAAATGGGCTGTTGCAAGG - Intronic
1006892708 6:37443181-37443203 TTGCAAAAAGAGCTTTTGGAAGG - Intronic
1010385087 6:75270408-75270430 CTGGAGAAGGGGCCTTTGGGAGG + Intronic
1011240364 6:85265963-85265985 CAGCAGAAAGGGATTTTGAAAGG - Intergenic
1012875804 6:104724296-104724318 CTCAAGAAAGGGGTGTTGGAAGG - Intergenic
1012942314 6:105428220-105428242 CTAGAGAAAGGGCTCTTAGAAGG - Intergenic
1014826386 6:126052617-126052639 CTTCAGAAAAGGCTTTTGGCCGG - Intergenic
1015359472 6:132321966-132321988 CTGGAGACAGGGTTTTTAGATGG - Intronic
1016439983 6:144073641-144073663 CTGTAGCAAGGGCTTATGGGAGG - Intergenic
1017829746 6:158115601-158115623 CTGCAGAAAGGCCTTCTGCAAGG + Intronic
1018737872 6:166702328-166702350 CTGCAGAAAGGGGTTTTGCTGGG + Intronic
1019852742 7:3575551-3575573 CTGTAGATAGTGCTTTTTGCTGG + Intronic
1019988005 7:4672239-4672261 CTGCAGAAAGTTCTGTTGGACGG - Intergenic
1020125608 7:5531060-5531082 CTGCAGAAGGAGCTCTTGGAGGG + Intronic
1022467056 7:30659113-30659135 ATGTAGATAGAGCTTCTGGAAGG + Intronic
1022835574 7:34110613-34110635 CTGTACAAATGGATTTAGGATGG + Intronic
1027267277 7:76501344-76501366 ATGTGGCAAGGGCTTGTGGAAGG - Intronic
1027319088 7:77001209-77001231 ATGTGGCAAGGGCTTGTGGAAGG - Intergenic
1031878009 7:127163555-127163577 CTGAAGAAAGTGGTTATGGAAGG - Intronic
1032018251 7:128393080-128393102 CTGGGGAAAGGGTTTTGGGAAGG - Intronic
1032390114 7:131550344-131550366 CTTTAAAAAGGACTTTAGGATGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1035074339 7:156168667-156168689 CTGTAGGAAGGCCTCGTGGATGG - Intergenic
1035912244 8:3580316-3580338 CTGTAAGAAGTGGTTTTGGAAGG + Intronic
1036997436 8:13675395-13675417 ATGTAGAAAGTGTTTTTTGAGGG - Intergenic
1037084497 8:14830966-14830988 GTGTAGAAAGAGCTCTTGAAAGG + Intronic
1039050268 8:33486203-33486225 CTGTGTGAAGGACTTTTGGAGGG + Intronic
1039375008 8:37024324-37024346 GTGTAGAAAGTGTTTTTGGCAGG + Intergenic
1040462687 8:47664060-47664082 CTCTAGAAAGTGAGTTTGGATGG - Intronic
1040906471 8:52474297-52474319 CTGTAGAAAGGGTTGTTTGGGGG - Intergenic
1041326178 8:56667705-56667727 ATGTAGAGATGGCTTTGGGAAGG - Intergenic
1041598606 8:59687945-59687967 CTGTAGAAGAGACTTCTGGAAGG - Intergenic
1041982524 8:63879353-63879375 TTGGAAATAGGGCTTTTGGAAGG - Intergenic
1044459234 8:92425830-92425852 CTGTAGCAATGGCTTTTGCCTGG + Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1045794041 8:106021694-106021716 ATGGAGGTAGGGCTTTTGGAAGG + Intergenic
1046100008 8:109603288-109603310 TTGTAGAAAATGTTTTTGGAAGG - Intronic
1047781575 8:128115987-128116009 CTGTAGACATGTCTTTTGGGGGG - Intergenic
1047843479 8:128779966-128779988 CTGGAGACGGGGCTTTTGGGAGG - Intergenic
1048031548 8:130638044-130638066 TTGGAGATAGGGCTTTTAGAAGG + Intergenic
1048621897 8:136142847-136142869 AGGTAGAAAAGGTTTTTGGAGGG + Intergenic
1049932891 9:473171-473193 CTGTAGAAAGGAATTATGAAAGG - Intronic
1050026860 9:1343800-1343822 TTGCAGATGGGGCTTTTGGAAGG - Intergenic
1051043611 9:12846900-12846922 CAGTAGAAAATGTTTTTGGAAGG - Intergenic
1051200112 9:14608067-14608089 CAGTATGAAGGGTTTTTGGATGG - Intergenic
1055364167 9:75526182-75526204 CTGGAGCTTGGGCTTTTGGAAGG - Intergenic
1056454230 9:86744915-86744937 CTCTAGAAAGGATTTCTGGAAGG - Intergenic
1057615617 9:96587243-96587265 TTGCAGAAAGTTCTTTTGGATGG - Intronic
1057838770 9:98468168-98468190 CTGAAGAACGTGCTTCTGGAGGG + Intronic
1058536547 9:105966259-105966281 CTGTAGAAGAGGCTATGGGAGGG + Intergenic
1059388918 9:113986656-113986678 CTGAAGAAAGGGTCTTTGGGAGG - Intronic
1059771498 9:117430821-117430843 TTGGAGATAGGGCTTTTAGAAGG - Intergenic
1060554601 9:124501752-124501774 CTGGAGAAAGGACTCCTGGATGG - Intronic
1203775541 EBV:71160-71182 CTGTAGGAACGGGTCTTGGATGG + Intergenic
1188313291 X:28643802-28643824 CTGAAGAGAGGGATTTGGGAAGG - Intronic
1188589824 X:31820281-31820303 CTGGAGAAAGGGTTTTTGTATGG - Intronic
1189204171 X:39223588-39223610 TTGGAGATAGGGCCTTTGGATGG - Intergenic
1190495918 X:51028511-51028533 CTGGAGAAAAGTTTTTTGGAAGG - Intergenic
1190510069 X:51165586-51165608 CTGGAGAAAAGTTTTTTGGAAGG + Intergenic
1190682258 X:52836847-52836869 ATGTAGAAAAGGCCTTTGGCCGG - Intergenic
1194039046 X:88917037-88917059 CAGGAGAAAGGGCTTATAGAAGG - Intergenic
1196124239 X:112082491-112082513 GTGTAGAAAAGGGTTTTGGAGGG - Exonic
1198206052 X:134466039-134466061 TTGGAGACAGGGCCTTTGGAAGG + Intronic
1200971604 Y:9158484-9158506 CTGATGAAATGGCTGTTGGAGGG + Intergenic
1202139414 Y:21705813-21705835 CTGATGAAATGGCTGTTGGAGGG - Intergenic