ID: 1172965931

View in Genome Browser
Species Human (GRCh38)
Location 20:38835313-38835335
Sequence CAGGACATGATGGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172965931 Original CRISPR CAGGACATGATGGGGGCTGC AGG (reversed) Intronic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
901013809 1:6216217-6216239 GGGGACATGAAGGGGGCTTCTGG + Intronic
901145960 1:7064768-7064790 CGGGGCATGGTGGGGGCTGTAGG + Intronic
903145713 1:21370789-21370811 CAAGAAGTGATGGGGGCTGGAGG + Intergenic
903347909 1:22699435-22699457 CAGGGCCTGTTGGGGGGTGCGGG + Intergenic
903666963 1:25014054-25014076 AAGGGGAGGATGGGGGCTGCGGG - Intergenic
903887791 1:26551107-26551129 CAGGTCTTGATGGGGTCTGGTGG + Intronic
903954898 1:27018580-27018602 CTGGAGATGATGGGGGATGTAGG + Intergenic
904433637 1:30480277-30480299 CAGGACAGGATGGGGGTTACAGG + Intergenic
904466721 1:30712450-30712472 CAGGGCATGTTGGGGGCGGGAGG + Exonic
905516382 1:38564950-38564972 CAGACCATGGTGGGGGCTGGCGG - Intergenic
905653834 1:39673156-39673178 CAGGACCTGGTGGAGGCTGAGGG - Intergenic
906613517 1:47219753-47219775 CATGGCAGGATGGAGGCTGCGGG + Exonic
906749619 1:48247328-48247350 CAGGACCTGCTTGGGGCTGGAGG - Exonic
910775240 1:90868164-90868186 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
911551468 1:99287041-99287063 CAGGGCATGTTGGGGGTTGAGGG - Intronic
911740153 1:101378213-101378235 AGGGACATGATGGGGGCAGAGGG + Intergenic
911947129 1:104126067-104126089 AAGGACCTGGTAGGGGCTGCAGG + Intergenic
912827903 1:112923408-112923430 CGGGACATGATGGCGGCAACAGG - Intronic
912940256 1:114038515-114038537 CAGGCCATGATGGGAGGTGGGGG + Intergenic
912947238 1:114095530-114095552 CAGCACAAGATGGGGGCTCACGG + Intronic
915545073 1:156592387-156592409 CAGGACAGTAGGGGGGCTCCTGG - Exonic
916660889 1:166921442-166921464 CAGGACACGATGGGTGCTCTTGG - Intronic
918156774 1:181855054-181855076 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
918852419 1:189709041-189709063 AACAACATGATGGGGGCTGCTGG - Intergenic
919082334 1:192881366-192881388 CAGGACCTGTTGGGGGGTGGGGG + Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
920230150 1:204464735-204464757 CAGGCCAGGATGGGGGCAGTGGG + Intronic
920255512 1:204651745-204651767 GAGCAGGTGATGGGGGCTGCTGG + Intronic
920540101 1:206771736-206771758 CAGGACATGAGGGGGGCTCAAGG - Intronic
920928330 1:210363667-210363689 CAGGTCATGGTGGGGGCTTCGGG + Intronic
921063952 1:211609633-211609655 CAGGAGTTGTTGGGGGCTGCAGG - Intergenic
922572787 1:226643728-226643750 CAGGAGGTGATGAGGGCTGGAGG + Intronic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1062824372 10:557467-557489 CAGGCCATGATGGCCTCTGCTGG + Intronic
1063046623 10:2398819-2398841 CAGGAGATGAGGGTGACTGCAGG - Intergenic
1063303641 10:4876611-4876633 CAGGGCATGGTGGTGGCAGCAGG - Intergenic
1064136802 10:12757992-12758014 CTGGGCATGATGGCGGGTGCCGG - Intronic
1064448704 10:15421890-15421912 CAGGGCATGTTGGGGGGTGGGGG - Intergenic
1065970121 10:30799374-30799396 CAGGCCGTGCTGGGGGCTGGGGG + Intergenic
1066525699 10:36276737-36276759 CAGGACCTGTTGGGGGGTGGAGG + Intergenic
1067720221 10:48722498-48722520 CAGGACTAGATGCAGGCTGCTGG - Intronic
1067796960 10:49327702-49327724 CAGGAACTGATGGGGGGTGAGGG - Intergenic
1068206305 10:53859173-53859195 GAGGAGATGATGGGAGCTTCAGG - Intronic
1068427693 10:56888990-56889012 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
1068584639 10:58783193-58783215 CAGGAGAGGGTGGGGGCTGGAGG + Intronic
1068718405 10:60214514-60214536 CAGGGCCTGTTGGGGGCTGGGGG - Intronic
1068955381 10:62815759-62815781 CAGGAGAGGATTGGGGCTCCAGG - Intronic
1070325070 10:75383505-75383527 CAGGAAATGCTGGGGTCTGAGGG - Intergenic
1071568538 10:86684149-86684171 GAGGAGAAGAAGGGGGCTGCTGG - Intronic
1071706137 10:88000937-88000959 CAACACATGATGGGGCCTGTTGG + Intergenic
1073952951 10:108831857-108831879 CAGGACATGGATGGAGCTGCAGG + Intergenic
1075636289 10:124033024-124033046 CAGGAGATTTTGGGGGTTGCTGG - Intronic
1075848545 10:125567290-125567312 CAGGCCATGATGGGAACTGGGGG - Intergenic
1077088239 11:765396-765418 CAGGACAGGAGGGGGGCGGGGGG - Intergenic
1077309867 11:1883516-1883538 CAGGACAACCTGGGGGCCGCAGG + Exonic
1077374665 11:2199916-2199938 CAGCTCAGGAAGGGGGCTGCTGG - Intergenic
1077582559 11:3426169-3426191 CTCGATATGATGGGGCCTGCTGG - Intergenic
1077640831 11:3880025-3880047 CAGGACAGGATGTGTGGTGCTGG + Intronic
1077655071 11:4010871-4010893 CAGGGCCTGTTGGGGGCTGGGGG - Intronic
1078484060 11:11705688-11705710 GATCACATGATGGGGTCTGCTGG - Intergenic
1081083486 11:38771487-38771509 CAGGGCATGTTGGGGGGTGGGGG - Intergenic
1081135200 11:39431919-39431941 CAGGGCCTGTTGGAGGCTGCGGG + Intergenic
1082884196 11:58066589-58066611 GAGGCAAGGATGGGGGCTGCTGG - Intronic
1083889398 11:65588474-65588496 CAGGCCATGGTGGTGGCTGGTGG + Intronic
1083966789 11:66048471-66048493 CAGGACAGGATGGAGTCTCCGGG - Intronic
1084054415 11:66623089-66623111 CAGGTCATAATGAGAGCTGCAGG + Intronic
1084176551 11:67425284-67425306 CAGGACATGATGCAGGGTCCAGG + Exonic
1084372174 11:68751341-68751363 CAGGCGGGGATGGGGGCTGCCGG - Intronic
1084935669 11:72585306-72585328 AAGGAGATGATGGGGACTGAAGG + Intronic
1085031506 11:73273700-73273722 CAGGCCATGCTGGGAGCTCCCGG - Intronic
1087673320 11:101130218-101130240 CAGGACATGTTGGTCGCAGCAGG - Exonic
1091382314 12:69884-69906 CAGGACAAGATGGAGCCAGCAGG + Intronic
1091692437 12:2606196-2606218 GAGGACACGAGGGGTGCTGCAGG - Intronic
1091937379 12:4444681-4444703 CAAGAAAGGATGGGGGCTGCAGG - Intronic
1092410150 12:8246616-8246638 CTCGATATGATGGGGCCTGCTGG - Intergenic
1093110674 12:15148289-15148311 CTGGCCATGATGGGGACTTCTGG + Intronic
1094125056 12:27014529-27014551 CAGGACTTCCTGGGGGCTCCCGG - Intergenic
1094775808 12:33726253-33726275 CAGGGCCTGATGGGGGGTGGGGG - Intergenic
1095695334 12:45137511-45137533 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1096259273 12:50081045-50081067 CAGGACATCGTGGGGGCAGCAGG - Intronic
1099139957 12:78960622-78960644 CATGTTATGAAGGGGGCTGCAGG + Intronic
1100064230 12:90621849-90621871 CAGGTTATGATGGATGCTGCTGG + Intergenic
1100618492 12:96249862-96249884 CAGGCCATGCTGGTGGCTTCTGG - Intronic
1100929747 12:99593151-99593173 CTGGCCATGATGGGGGTTGAGGG - Intronic
1101087387 12:101250218-101250240 CTGGGCATGATGGTGGGTGCTGG - Intergenic
1102587127 12:113931350-113931372 GAGGCCATGCTGAGGGCTGCTGG - Intronic
1102624866 12:114226826-114226848 CAGGAAAAGATGGGGGCCCCAGG + Intergenic
1103359136 12:120343119-120343141 CAGGAGGTTATGGGGGCTCCCGG + Intronic
1103946687 12:124531244-124531266 AAGGACAGGGAGGGGGCTGCAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106102279 13:26705485-26705507 CAGGTCATGCAGGGGGATGCAGG + Intergenic
1106325810 13:28688263-28688285 CATTACATGCTGGGGCCTGCTGG - Intergenic
1106505722 13:30369039-30369061 CAGGAAATGATGGGGTTAGCAGG - Intergenic
1108604282 13:52021768-52021790 CTGGACCTGCTGGGGGCTGTCGG + Intronic
1109087793 13:57998587-57998609 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
1109815861 13:67583587-67583609 CCGGGCATGATGGCGGGTGCCGG + Intergenic
1110948590 13:81455992-81456014 AAGGACATTGTGGGGGTTGCTGG + Intergenic
1111770331 13:92588078-92588100 CAGGGCCTGTTGGGGGCTGGAGG - Intronic
1112911705 13:104493485-104493507 CAGGACCTGTTGGGGGGTGGGGG - Intergenic
1113289887 13:108893727-108893749 CAGGCCATCATGGGGAGTGCTGG + Intronic
1113330978 13:109327354-109327376 CAAGAGCTGATGGGGGCTGGAGG + Intergenic
1113511305 13:110856865-110856887 GAGGGCTTGATGGGGGCTGGAGG + Intergenic
1113938589 13:114007267-114007289 CAGGGCAGGAGGGGGGCGGCAGG - Intronic
1114710561 14:24773837-24773859 CAGGACCTGTTGGGGGATGGAGG + Intergenic
1115467430 14:33731065-33731087 CAGGATTTGGTGGGGGCTGGAGG + Intronic
1116235967 14:42279885-42279907 CAGGGCGTGATGGGGGGTGGGGG - Intergenic
1116331846 14:43606464-43606486 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1117667296 14:58070005-58070027 CAAGACATGATGCTGGCTGAAGG + Intronic
1119599967 14:75968958-75968980 TAGGGAATGGTGGGGGCTGCGGG + Intronic
1119640568 14:76311378-76311400 CAGGTAATGATGGGAGCTCCTGG + Intronic
1119935593 14:78589711-78589733 CAGGACATGCCTGGGGCAGCAGG + Intronic
1121211304 14:92209880-92209902 TTGGACATGCTGGGGGCTGGTGG + Intergenic
1121717134 14:96084310-96084332 TTGGGCATGACGGGGGCTGCAGG - Intronic
1122399917 14:101460830-101460852 CAGGAGATGCTGGGGCATGCCGG + Intergenic
1122588293 14:102826433-102826455 CAGGACAGCATGGGAGCTGCTGG + Intronic
1122603219 14:102931316-102931338 CAGGCCATGACTGGGGATGCCGG - Intronic
1122789929 14:104179855-104179877 GAGGATGTGGTGGGGGCTGCGGG + Intronic
1123203676 14:106692009-106692031 CAGGACACCATGGGGCATGCAGG - Intergenic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124801661 15:32838878-32838900 CATGAGATAATGGGGACTGCTGG - Intronic
1126963790 15:54028544-54028566 CAGGAGATGAGGGAGGCAGCAGG - Intronic
1128080878 15:64856195-64856217 CAGGACAGGGTAGGGGCTCCAGG - Intronic
1128215423 15:65931019-65931041 ATGGACATGTTGGGGGCAGCAGG - Intronic
1128382155 15:67121141-67121163 CAGGACAGGGCGGGGGCTGCAGG - Intronic
1128682168 15:69660113-69660135 CAGGAAGGGGTGGGGGCTGCAGG + Intergenic
1128682672 15:69663006-69663028 CAGGAAGGGGTGGGGGCTGCAGG + Intergenic
1129064348 15:72888733-72888755 CAGGTAATGATGGAGACTGCAGG + Intergenic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1130274064 15:82467430-82467452 CAGAACATGAAGGGTACTGCTGG + Intergenic
1130466412 15:84194804-84194826 CAGAACATGAAGGGTGCTGCTGG + Intergenic
1130497852 15:84478732-84478754 CAGAACATGAAGGGTGCTGCTGG - Intergenic
1130588706 15:85199397-85199419 CAGAACATGAAGGGTACTGCTGG + Intergenic
1130880565 15:88052244-88052266 CAGGACGTGATAGGGGGTGATGG - Intronic
1131016127 15:89059130-89059152 GAGGGCATGATGGGAGATGCTGG - Intergenic
1131712231 15:95068372-95068394 CAGGAAATGCTGGGGGCACCAGG - Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132689456 16:1175986-1176008 CAGGACATCCTGGTGGCTGCTGG + Intronic
1133154305 16:3861972-3861994 GAGGAGAGGGTGGGGGCTGCCGG - Intronic
1133776354 16:8898227-8898249 CAGCACATGATGGGGGCTGGGGG - Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1136399518 16:30010082-30010104 CAGGACCTGAAGGGGGCGGCGGG - Exonic
1136637802 16:31537022-31537044 CAAGGCAAGGTGGGGGCTGCGGG + Intergenic
1136671734 16:31864683-31864705 CAGGACATGCCAGGGGCTGGTGG - Intergenic
1137573702 16:49584230-49584252 AGGGACACGATGGGGGCTGTGGG - Intronic
1137605899 16:49786595-49786617 CAGGGCATTATGGGGACTTCTGG - Intronic
1137825407 16:51490109-51490131 CAGCACATGATGGATGCAGCAGG - Intergenic
1138269333 16:55683794-55683816 GAGGACATGATGAGGACTTCAGG - Intronic
1138649582 16:58451675-58451697 CAGGACAAGACGGGGGCAGCCGG + Intergenic
1140408135 16:74724621-74724643 CATGACAAGCTGGGGGCTGAGGG + Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142272528 16:89097803-89097825 CAGGAGATGATGTGGCCTGCAGG + Intronic
1142523142 17:519054-519076 CAGGAGAGGTTGGGGGCTTCTGG + Exonic
1143310163 17:5981117-5981139 AAGAACATGATGGAGGCAGCTGG + Intronic
1143576130 17:7794361-7794383 GAGGACCTCATGGGGGCTGCAGG + Intronic
1143705686 17:8696464-8696486 CAGGACATCATGGGAGAGGCTGG + Intergenic
1144345927 17:14349683-14349705 CAGCACTTCCTGGGGGCTGCGGG - Intergenic
1144584773 17:16481612-16481634 CAGGCCATCATGGGGGAGGCAGG - Intronic
1146841399 17:36157956-36157978 CATGACATGATGGTAGCTGTGGG + Intergenic
1148215680 17:45833038-45833060 CAGGACAGGACTGGGGCTGGAGG - Intronic
1148491808 17:48028220-48028242 CAGGAGATGAGGTGGGCTGATGG + Intronic
1150425612 17:65074779-65074801 TGGGACATGCTGGGGGCTGGGGG - Intergenic
1151490407 17:74429745-74429767 CAGACCCTGGTGGGGGCTGCTGG - Intronic
1151543903 17:74780286-74780308 CAGGTCATGAGTGAGGCTGCTGG + Intronic
1152234993 17:79134042-79134064 CAGGACATGAGGTGGGCAGGAGG + Intronic
1152350708 17:79782456-79782478 CAGGACAGGATGGGGGAGGAGGG + Intronic
1152756413 17:82088868-82088890 CAGGACAGCCTGGGGGCGGCAGG + Exonic
1155239133 18:23848415-23848437 CAGGACTGGGTGGGGGCTGCAGG + Intronic
1155407787 18:25508992-25509014 GAGGACGTGATGGGCTCTGCAGG + Intergenic
1157494743 18:48148389-48148411 CAGGACATGATGGGAAATACTGG + Intronic
1157678066 18:49582218-49582240 CAAGAGCAGATGGGGGCTGCAGG + Intronic
1157876126 18:51275259-51275281 CAGGATAGGAAGGGGGCGGCAGG - Intergenic
1158266720 18:55667045-55667067 CAGGGCATGCTGCAGGCTGCAGG + Intergenic
1158403746 18:57143152-57143174 CAGCACATGATGGGGGAAGTTGG + Intergenic
1160201137 18:76796350-76796372 AAGGAACTGATGGGGGCTGGGGG - Intronic
1160702930 19:517337-517359 CAGGGCTGGATGGGAGCTGCGGG + Intronic
1160793726 19:934381-934403 CAGGACATGCTGCGGGCTGTGGG - Intronic
1161062901 19:2223914-2223936 CAGGACATGATGGAAGGTTCTGG - Intronic
1161204545 19:3034218-3034240 CTGGTCAGGGTGGGGGCTGCTGG - Intronic
1161390332 19:4017250-4017272 CGGGACATGGGGGTGGCTGCTGG - Intronic
1161442817 19:4302185-4302207 CAGAACGTGATGGGGGCTGGAGG - Intronic
1161994799 19:7705653-7705675 AAGGACATGATGGGGCCGGTGGG - Intergenic
1162134703 19:8548201-8548223 GAGGACAGGATGTGGGCTGGAGG + Intronic
1162527819 19:11216876-11216898 CAGGAGATGATGGAGGAGGCAGG - Intronic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1162838570 19:13338716-13338738 CAGGATATGAGGGGGGCTTCTGG + Intronic
1163266501 19:16225530-16225552 CAGGACAGGCTAGGGGGTGCAGG + Intronic
1163343846 19:16727381-16727403 CTGGAGGTGGTGGGGGCTGCAGG + Intronic
1164702173 19:30293420-30293442 TAGGGGATGTTGGGGGCTGCAGG + Intronic
1164801308 19:31079082-31079104 CTGGCCTTGATGTGGGCTGCTGG + Intergenic
1165434514 19:35788701-35788723 CAGGACATGCTGGGGGCTCCTGG - Exonic
1165471350 19:36006588-36006610 CAGGACCTGGTGGGGTCTGGGGG - Exonic
1165735032 19:38170392-38170414 CAGCACATGAGGGGGGCTGCTGG - Intronic
1165941043 19:39414994-39415016 GAGGCCATGGTGGGGGCTGCAGG - Exonic
1166518773 19:43465522-43465544 CAGGCCATGATCTGGACTGCAGG - Exonic
1167416346 19:49375052-49375074 CAGGGTCTGATGGGGGCTACAGG - Exonic
1167509742 19:49889751-49889773 CAGGTCATGCGAGGGGCTGCTGG + Exonic
1168405384 19:56107815-56107837 CCGGGCATGCTGGGGGCTGCGGG + Intronic
1168405405 19:56107893-56107915 CCGGGCATGCTGGGGGCTGCGGG + Intronic
925843925 2:8018937-8018959 CAGGACATAAAGGGGGCTGAGGG + Intergenic
928050915 2:27994444-27994466 CAGGACATGAGTGAGGCTTCTGG - Intronic
929910076 2:46082357-46082379 CAGGACTTGGTGAGGGCTGAGGG + Intronic
931415783 2:62079038-62079060 TAGGACATGATGGGAGGTGGGGG - Intronic
931871235 2:66462383-66462405 CAAGACATGTGGGAGGCTGCAGG - Intronic
932381914 2:71291959-71291981 CAGGTCATGCTGGGAACTGCTGG - Intronic
935627504 2:105183530-105183552 CAGGGAATGATGTGGGCTGAAGG + Intergenic
935853098 2:107244414-107244436 CAGGGCATGGTGGTGGGTGCCGG - Intergenic
937494940 2:122408495-122408517 CAAGAGATAATGGGGCCTGCAGG + Intergenic
937906133 2:127053756-127053778 CAGGAGGTGATGAGGGCTGAAGG + Intronic
938688780 2:133766939-133766961 CAGTACATGATAGGGTGTGCAGG + Intergenic
938989168 2:136610351-136610373 CAGGACCTGTTGGGGGATGGGGG + Intergenic
939209347 2:139152816-139152838 AAGGACATGATTGGAGCTGGAGG + Intergenic
939821191 2:146958929-146958951 CTGGACATGGTGGGTGGTGCCGG + Intergenic
940963678 2:159814142-159814164 CAGGACAGGCTGGGGGGTGGTGG - Intronic
941894373 2:170614467-170614489 CAGCTCATGATGGGTGCAGCTGG - Intronic
942088146 2:172462470-172462492 CATGGCAGGATGGGGGCAGCAGG - Intronic
943980605 2:194544823-194544845 CAGGACCTGTTGGGGGGTGGGGG + Intergenic
944286444 2:197955541-197955563 CAGGGCCTGATGGGGGATGGGGG - Intronic
944929554 2:204502076-204502098 CAGGACAAAATGGGGGCTTCAGG + Intergenic
945753896 2:213822730-213822752 CAGGGCCTGTTGGGGGCTGGGGG - Intronic
946430337 2:219623379-219623401 CAAGACATGGTGGGGGAGGCTGG + Intergenic
947137187 2:226987165-226987187 CAGGGCCTGTTGGGGGCTGGGGG + Intronic
947241686 2:228001722-228001744 CAGGGCCTGTTGTGGGCTGCGGG - Intronic
947703552 2:232256235-232256257 CAGGACATGAGAGGAGATGCTGG - Intronic
947758457 2:232586453-232586475 CTGGACATTCTGAGGGCTGCAGG - Intergenic
948125398 2:235561316-235561338 CAGGAGCTGCTGGGGTCTGCGGG + Intronic
948233816 2:236371596-236371618 CAGGACAAGGTGAGGGCTTCAGG - Intronic
949075984 2:242058245-242058267 CAGGCTCTGATGTGGGCTGCTGG - Intergenic
1169092856 20:2872219-2872241 CTGGAGATGGTGGGGGCTGCTGG + Intronic
1169194848 20:3677508-3677530 GAGGACATTATGGGGGCATCGGG + Intronic
1172008879 20:31834834-31834856 CAGCACATGATGTGGGCAGGTGG + Intergenic
1172385775 20:34533078-34533100 CAGGTCATGATTGGGCCAGCAGG - Intronic
1172609676 20:36240602-36240624 AAGCACATCCTGGGGGCTGCTGG - Exonic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173743169 20:45416638-45416660 CTGCACCTGATGGGGCCTGCAGG - Exonic
1175247064 20:57588657-57588679 CAGGACATAGTGGGGTCTGCAGG - Intergenic
1175275221 20:57763864-57763886 AAGGGCAAGATTGGGGCTGCCGG + Intergenic
1175547046 20:59785069-59785091 CAGGAGGGGATGGGGTCTGCAGG + Intronic
1175817539 20:61891352-61891374 CAGGACAGGGAGGGGCCTGCAGG - Intronic
1175876110 20:62230956-62230978 CAGGACATGATGGGGCCATCTGG + Intergenic
1176282884 20:64324949-64324971 CAGGACAAGATGGAGCCAGCAGG - Intergenic
1177029924 21:15969690-15969712 CAGGACATGATCGGGATTCCTGG + Intergenic
1177960490 21:27660506-27660528 CAGGTGTTGATGGGGGCTGCTGG - Intergenic
1179599662 21:42467992-42468014 AAGGACATGATGGGGGCAACTGG + Intergenic
1179625848 21:42649335-42649357 GAGCACATGCTGGGAGCTGCTGG + Intergenic
1179902159 21:44399918-44399940 CAGGACATGACGGGAGCTCATGG - Intronic
1180032525 21:45222203-45222225 GCAGACATGATGGGGGGTGCAGG + Exonic
1181273587 22:21674897-21674919 AAGGACCTCACGGGGGCTGCAGG - Intronic
1181990147 22:26831113-26831135 CAGGCCTGGGTGGGGGCTGCAGG - Intergenic
1182015886 22:27039344-27039366 GAGGGCATGGTGGAGGCTGCAGG + Intergenic
1182452544 22:30429852-30429874 CAAGACAGGATGGGGGCTCCGGG + Intergenic
1182955443 22:34420038-34420060 CAGGATTTGGTGGGGGCGGCAGG - Intergenic
1183077745 22:35437403-35437425 CATGGCATGATGATGGCTGCTGG - Intergenic
1184640286 22:45866868-45866890 CAGGACTTGATCGGGGCTTGGGG - Intergenic
1184930016 22:47674040-47674062 CAGGGCCTGTTGGGGGTTGCAGG + Intergenic
1185009800 22:48306594-48306616 CAGGACGTGAGGGGGCCTGTAGG + Intergenic
1185377251 22:50488236-50488258 CAGGGCAGGTTGGGGACTGCAGG - Intronic
950090354 3:10290421-10290443 CAGGACTTGATAGGGGCTGGGGG + Intronic
953253518 3:41267166-41267188 CAGGGCCTGTTGGGGGATGCGGG - Intronic
953412746 3:42699418-42699440 AAGGGCACCATGGGGGCTGCCGG + Intronic
953853743 3:46485145-46485167 CAGGTGATGATAAGGGCTGCTGG + Intronic
954368730 3:50159347-50159369 CCAGAACTGATGGGGGCTGCTGG - Intronic
955341714 3:58130177-58130199 CAGGGCTGGATGTGGGCTGCAGG + Intronic
955600213 3:60636954-60636976 CAAGTCATGGTGGGGGCTGGTGG + Intronic
956056168 3:65301105-65301127 CTGGACATCATGGAGGCTACTGG - Intergenic
957425145 3:80028623-80028645 CAGGACCTGTTGGGGGTTGGGGG - Intergenic
957539645 3:81551314-81551336 CTTAACATGATGGGGGGTGCTGG + Intronic
957773122 3:84720008-84720030 CAGGGCCTGTTGGGGGCTGGAGG - Intergenic
958007227 3:87827251-87827273 CAGGGCCTGTTGGGGGTTGCGGG - Intergenic
959334983 3:105052768-105052790 AAGTACATGATGGGGTATGCTGG - Intergenic
961476936 3:127152886-127152908 CAGGCCATGCTGGGAGCAGCTGG + Intergenic
961597088 3:128026484-128026506 CAGAACAGCATGTGGGCTGCGGG + Intergenic
961621314 3:128227059-128227081 CAGGACATGGTGGACTCTGCAGG + Intronic
961889056 3:130115128-130115150 CTCGATATGATGGGGCCTGCTGG - Intergenic
963372422 3:144417829-144417851 CAGGACATGTTGGGGGGTTGGGG + Intergenic
963689803 3:148484125-148484147 CAGGGCCTGTTGGGGGCTGAGGG + Intergenic
963791661 3:149589106-149589128 CAGGACATGCTAGGCCCTGCTGG - Intronic
963878581 3:150503441-150503463 AAGGTGTTGATGGGGGCTGCTGG - Intergenic
963987173 3:151609816-151609838 CAGTAGATGCTGGGGACTGCTGG + Intergenic
964302215 3:155301092-155301114 CAGGACATAAGGGGGGATGTGGG + Intergenic
964767580 3:160193580-160193602 CAGGATGAGATGGGGGCTGGTGG + Intergenic
964859641 3:161186904-161186926 CAGGGCCTGTTGGGGGCTGGGGG + Intronic
967172160 3:186830131-186830153 GACGAGTTGATGGGGGCTGCAGG + Intergenic
967318384 3:188171944-188171966 GAGGGCATGATGTGGGCTGGTGG + Intronic
968656119 4:1779161-1779183 CTGGACATGCTCGGGGCTGGCGG - Intergenic
968757965 4:2426588-2426610 TAGGATCTGCTGGGGGCTGCTGG + Intronic
968933606 4:3597539-3597561 CAGGACAGGATACGGGCTGAGGG + Intergenic
968950629 4:3689702-3689724 CAGAAGATGATGTGGGCTTCAGG - Intergenic
968998198 4:3959049-3959071 CTCGATATGATGGGGCCTGCTGG - Intergenic
969480739 4:7445615-7445637 GAGGCCAGGATGGGGGCTGCAGG + Intronic
971257828 4:25030462-25030484 CGGGACGGGATGGGGGCTGGAGG + Intronic
974584630 4:63856126-63856148 AAGGACATGAAGGGAGCTGGAGG + Intergenic
976330502 4:83825837-83825859 CAGGACCTGTTGGGGGATGGGGG - Intergenic
977370292 4:96126360-96126382 CAGCACTTGGTGGGGCCTGCCGG - Intergenic
979086165 4:116411936-116411958 CATCACATGCTGGGGCCTGCTGG + Intergenic
981014973 4:139964427-139964449 CAGGGCCTGATGGGGGATGGGGG + Intronic
981603679 4:146520872-146520894 CAGGAGATGATGGGCACTGGTGG - Intronic
981822711 4:148904132-148904154 AAGGACAGGGTGGGGGCTGCTGG - Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
983512547 4:168624466-168624488 CAGGGCATGATGTGGGCTTTGGG - Intronic
984766709 4:183405495-183405517 GTGGACATGCTGGGGGCTGAAGG + Intergenic
985493402 5:191955-191977 CAGGACCTGCTGTGAGCTGCAGG + Exonic
985531310 5:435307-435329 CAGCACAGGCTGGGAGCTGCAGG - Exonic
985731910 5:1554061-1554083 GAGGACCAGATGGGTGCTGCTGG + Intergenic
986063752 5:4216007-4216029 AAGGCCATGATGGTGGCTGTGGG + Intergenic
986137912 5:4999809-4999831 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
986143372 5:5052370-5052392 TAGGAGCTGATGAGGGCTGCTGG + Intergenic
986444417 5:7808707-7808729 CAGGAAAGGGTGGGGGCTGGTGG - Intronic
986570176 5:9156354-9156376 AGGGACAAGATGGGGGCTTCAGG + Intronic
986982632 5:13466909-13466931 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
989647659 5:43653102-43653124 CTGGGCATGATTGGGGTTGCTGG + Exonic
990619440 5:57543820-57543842 CAGGGCCTGTTGGGGGCTGGAGG - Intergenic
990815199 5:59777006-59777028 CTGGACATGCTGGAGGATGCAGG - Intronic
991090628 5:62690640-62690662 CAGGTCATGGTGGGGAGTGCTGG + Intergenic
993425698 5:87761781-87761803 CAGGGCCTGTTGGGGGTTGCGGG - Intergenic
994094024 5:95832553-95832575 CAGGTCATGATGGGGGTGGGTGG + Intergenic
995675641 5:114659659-114659681 CAGGACCTGTTGGGGGCTGGGGG + Intergenic
997300709 5:132802184-132802206 CAGGACATGAGGTGGGCGGCAGG - Intronic
997432246 5:133848549-133848571 CAGGCCAAGATAGGGGCAGCTGG + Intergenic
997607162 5:135183298-135183320 CTGGGCATGATGGTGGGTGCCGG + Intronic
997771359 5:136557083-136557105 CAGGTATTAATGGGGGCTGCTGG + Intergenic
999322909 5:150625855-150625877 CAGGACAGGGTGGGGGATGGGGG - Intronic
999443807 5:151622816-151622838 CAGGACATCAAAGGTGCTGCAGG + Intergenic
1001989567 5:176105076-176105098 CAGCCCATCATGGGGGCAGCAGG - Intronic
1002026190 5:176397552-176397574 GGGGACATGAGGGGGGCTGTGGG - Intronic
1002227305 5:177733062-177733084 CAGCCCATCATGGGGGCAGCAGG + Intronic
1005637849 6:27768280-27768302 CAGGACAAGATGGGGACTTGTGG - Intergenic
1005870333 6:29970734-29970756 CAGGCCAGGGTGGGGGCAGCAGG - Intergenic
1006315669 6:33290063-33290085 CAGAAAAGGATGGGGGCAGCGGG - Intronic
1006369483 6:33634955-33634977 CCGGTCAAGATGGGGGCTGTGGG + Intronic
1006587136 6:35122821-35122843 CAGGACATGGTGGGGGCCTAGGG + Intronic
1006750896 6:36376134-36376156 CAGAAGATGATGGGGGTTGGGGG - Intronic
1007387129 6:41527841-41527863 CAGGACATGAGGGAGGGTTCCGG + Intergenic
1007506146 6:42336975-42336997 CAGCTCATGATAGGAGCTGCGGG + Intronic
1009208442 6:60832897-60832919 GATGGGATGATGGGGGCTGCTGG - Intergenic
1010762642 6:79741281-79741303 CAGGACCTGTTGGGGGTTGGGGG + Intergenic
1012229812 6:96747616-96747638 CAGGACATGATGGCTCCTGCAGG - Intergenic
1014904065 6:127004879-127004901 CAGGACCTGAAGGGGCCTGCAGG + Intergenic
1015802635 6:137076137-137076159 CAGGACCTGCTGGGGGTTGGGGG + Intergenic
1016544781 6:145208816-145208838 CAGGACAGGATGAGGGCTGAGGG - Intergenic
1016781999 6:147969103-147969125 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
1017767069 6:157615669-157615691 CACCACATGATGGGCACTGCTGG - Intronic
1017882567 6:158572095-158572117 CAGGCCCTGCTGGGGGCAGCGGG + Intronic
1018030025 6:159834345-159834367 CAGGAAATGGTGGGGGGTGAGGG - Intergenic
1018056046 6:160053258-160053280 CAGGGCCTGTTGGGGGCTGGGGG + Intronic
1018733625 6:166671443-166671465 CAGTACACCATGGGGGCTCCAGG - Intronic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1019542344 7:1557205-1557227 CAGGACAAGAGGTGGGCTGAGGG - Intronic
1021822038 7:24507886-24507908 CAGGAACTGGTGGGGGTTGCAGG + Intergenic
1022375640 7:29808049-29808071 CAGGACATGAGGGAGGCTTCTGG + Intronic
1023191917 7:37592208-37592230 CAGGAGATGGTGGAGGCTGATGG - Intergenic
1023604896 7:41920925-41920947 CTGGTCATGATGGGTGCTACGGG + Intergenic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1024117653 7:46208879-46208901 CAGCACTTGAAGGGGGCAGCGGG + Intergenic
1025919889 7:65901653-65901675 GAGGACAAGATGGGGGTTGGCGG + Intronic
1026775260 7:73227226-73227248 CAGGAAGTGATGGGGGCGGGCGG - Intergenic
1027016117 7:74780597-74780619 CAGGAAGTGATGGGGGCGGGCGG - Intronic
1027071911 7:75165340-75165362 CAGGAAGTGATGGGGGCGGGCGG + Intergenic
1027973783 7:85122075-85122097 CAGGGCCTGTTGGGGGCTGGGGG + Intronic
1028805408 7:95020613-95020635 GGGGACAGGATGGGGGCTGGTGG - Intronic
1028846343 7:95484417-95484439 GAGGACATAAAGGGGGCTTCAGG + Intronic
1029021379 7:97368183-97368205 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1029438589 7:100575491-100575513 CAGGACAAGATGGGGCCTGCAGG + Intronic
1029609430 7:101618823-101618845 CAGGGCCTGGTGTGGGCTGCAGG - Intronic
1032159122 7:129497232-129497254 CAGGGAATGATGGGGGCTAAGGG + Intergenic
1033242055 7:139688511-139688533 CAGGAGCTGATGGCTGCTGCCGG + Intronic
1034020465 7:147636597-147636619 CAGGGCTTGTTGGGGGGTGCAGG - Intronic
1034060139 7:148079852-148079874 CAGGTCATGATGGGGAGTGGGGG - Intronic
1036004608 8:4647568-4647590 CAGGACATATTGGGGGGTGGGGG - Intronic
1036379044 8:8224911-8224933 CTCGATATGATGGGGCCTGCTGG + Intergenic
1037531925 8:19784690-19784712 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1038400363 8:27279841-27279863 AAAGCCATGCTGGGGGCTGCAGG + Intergenic
1039608875 8:38903436-38903458 CATGACATGATGGGATCTGCAGG - Intronic
1039648113 8:39309105-39309127 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1039755432 8:40517416-40517438 CAGGACAGGAGGTGAGCTGCCGG - Intergenic
1040340103 8:46436117-46436139 CAGGACACCCTGGGGGCTTCTGG + Intergenic
1040737089 8:50521256-50521278 CAAGGCCTGATGGGGGCTGGGGG + Intronic
1042484138 8:69333048-69333070 CCGGACATGATGGCGGGCGCCGG + Intergenic
1042671896 8:71273258-71273280 CAGGTCATGATGGTGGTTTCTGG - Intronic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1044707685 8:95024708-95024730 CAAGAAGTGATGGGTGCTGCTGG - Intronic
1045335729 8:101202636-101202658 CAGGACATGAAGGGGACTTATGG + Exonic
1046433379 8:114156340-114156362 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1046902239 8:119535893-119535915 CAGCACTTGATGGGTGCTGGTGG + Intergenic
1048531301 8:135252874-135252896 CATGACAGGATGGGGTCTTCAGG - Intergenic
1048865073 8:138754866-138754888 CGGGCCATGATGGGGGTTTCTGG - Intronic
1049165377 8:141122300-141122322 CAGGCCATGAGGGGAGCAGCAGG - Intronic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049689216 8:143951416-143951438 CAGCACATGAGGAGGGCTGCAGG + Intronic
1049782309 8:144434616-144434638 CAGCAGATCATGGGGGCTGAGGG + Intronic
1050505313 9:6342272-6342294 AAGGAGTTGATGGGAGCTGCTGG - Intergenic
1050885633 9:10761765-10761787 CAAGACATGTTGGGAGCTTCTGG - Intergenic
1051369661 9:16347505-16347527 CAGGAAAGGATGAGGGCTGTGGG - Intergenic
1053482796 9:38428411-38428433 CAAGACTTGAGGGAGGCTGCTGG + Intergenic
1054456541 9:65434278-65434300 CAGGACAGGATCCGGGCTGAGGG - Intergenic
1054460638 9:65460414-65460436 CAGGACAGGGTGTGGGCTCCAGG + Intergenic
1055375524 9:75645519-75645541 GGGGACATGATGGGGGCAGGAGG - Intergenic
1056557316 9:87700397-87700419 AAGGAGATGATGGGAGCTGAAGG + Intronic
1056793427 9:89640519-89640541 CAGGATATGTTGTGGGCAGCTGG + Intergenic
1057199603 9:93133203-93133225 CAGGACATGTTCGGGGAGGCGGG - Intronic
1057554006 9:96073056-96073078 CTGCCCATGCTGGGGGCTGCTGG + Intergenic
1058714656 9:107712899-107712921 CAGGGCATGATGTGGGGTGTGGG + Intergenic
1060410121 9:123394719-123394741 CAGCACAGGATGTGGGCTTCAGG + Intronic
1060900227 9:127250533-127250555 CATGATATTTTGGGGGCTGCTGG + Intronic
1061862470 9:133475156-133475178 CAGGGCAGGATGGCGCCTGCTGG - Intronic
1062023746 9:134331002-134331024 CAGGCCATGATGGTCGCTGGGGG + Intronic
1062096157 9:134705026-134705048 CAGGGGAAGATTGGGGCTGCTGG - Intronic
1062291551 9:135797497-135797519 CTGAACATGAAGGGTGCTGCTGG + Intergenic
1062413479 9:136436332-136436354 GTGGACATGATGGGCGCTGCCGG - Intronic
1185988196 X:4860291-4860313 CAGGACCTGTTGGGGGATGAGGG + Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1189586166 X:42464253-42464275 GAGGACTTGACTGGGGCTGCAGG + Intergenic
1189925225 X:45946383-45946405 CAGGGCCTGTTGGGGGCTGGGGG - Intergenic
1190746017 X:53321835-53321857 CTGCCCATGATGGGGGCTGGAGG - Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1191646682 X:63488825-63488847 CTGGACCTGACTGGGGCTGCGGG + Intergenic
1191788415 X:64942484-64942506 CAGGACCTGTTGGGGGGTGGGGG - Intronic
1191978955 X:66904401-66904423 GGGGACCTGATGGGGGCTGTAGG + Intergenic
1192065571 X:67881209-67881231 CAGGACATGATGGGAAGTGGGGG - Intergenic
1192525262 X:71837410-71837432 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic
1192736171 X:73851367-73851389 CAGGAAAAGATGGCGGCTGAAGG - Intergenic
1193446054 X:81603815-81603837 CAGGTCCTGTTGGGGGCTGGGGG + Intergenic
1195494349 X:105512922-105512944 CAGGGCATGTTGGGGGTTGGGGG - Intronic
1195897589 X:109762756-109762778 CAGGGCCTGTTGGGGGCTGGGGG + Intergenic