ID: 1172969547

View in Genome Browser
Species Human (GRCh38)
Location 20:38863355-38863377
Sequence GGGAGTTAAACCTGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172969547_1172969552 6 Left 1172969547 20:38863355-38863377 CCCTGCTGACAGGTTTAACTCCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1172969552 20:38863384-38863406 GCTGAGCCCCTGCAGAGCCCAGG 0: 1
1: 0
2: 3
3: 48
4: 443
1172969547_1172969556 20 Left 1172969547 20:38863355-38863377 CCCTGCTGACAGGTTTAACTCCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1172969556 20:38863398-38863420 GAGCCCAGGACCACTCCACTAGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172969547 Original CRISPR GGGAGTTAAACCTGTCAGCA GGG (reversed) Intronic
900183426 1:1322370-1322392 AGGAGATATCCCTGTCAGCAAGG + Intronic
906525836 1:46492830-46492852 GTGAGTTTAACCTGTGAGTATGG - Intergenic
906730106 1:48073703-48073725 TGGAGTCAAACCTGACAACAAGG - Intergenic
906856436 1:49310940-49310962 GGGATTTAAACCAGGCAGCCAGG + Intronic
909065952 1:70935944-70935966 GGGAGTTAAAAAGTTCAGCATGG + Intronic
913177138 1:116285269-116285291 TGCAGTTTAAACTGTCAGCATGG + Intergenic
917077840 1:171224086-171224108 AGGAGTTAACTCTGTAAGCATGG - Intergenic
919464918 1:197915513-197915535 GGCAGCTATACCTGACAGCAGGG - Intronic
922451050 1:225737662-225737684 GGGAGTGAAACGAGTTAGCAAGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1073794761 10:106975653-106975675 AGGAGTTAATCCTGTAGGCAAGG - Intronic
1076190492 10:128479848-128479870 GGGAGCCACACCTGCCAGCATGG + Intergenic
1076380884 10:130023839-130023861 GGGAGTGAAGCCTGTCGGGAAGG - Intergenic
1076777230 10:132704574-132704596 GGGACTTGAACCTGGCAGCCTGG + Intronic
1077141302 11:1026106-1026128 GGGAGGTGGGCCTGTCAGCAGGG - Exonic
1078688237 11:13552740-13552762 GGTTGTGAAACCTGTGAGCAAGG + Intergenic
1078693051 11:13601285-13601307 GGTTGTGAAACCTGTGAGCAAGG - Intergenic
1079662479 11:23057134-23057156 GGAAGTTAAAAATATCAGCAAGG - Intergenic
1080405222 11:31972702-31972724 GGGAGTTAAACCAGGCAGTCTGG + Intronic
1085387246 11:76164276-76164298 GTGAGATAAACCTGTTTGCAAGG + Intergenic
1089082866 11:115791825-115791847 GGGAGTCAAACCTCTCTGCAGGG - Intergenic
1089143274 11:116305343-116305365 GAGAGTTAAACCTCTGAGAAGGG - Intergenic
1093159580 12:15730449-15730471 GGGAGTATAAACTGTAAGCATGG + Intronic
1095477336 12:42599045-42599067 GGCAGGCAAGCCTGTCAGCAGGG + Intergenic
1100213334 12:92421148-92421170 TGGAGGTAAACTTGTTAGCAAGG + Exonic
1106275120 13:28197271-28197293 CTGATTTACACCTGTCAGCAAGG - Exonic
1107780033 13:43890192-43890214 GGGAGAAAAACTTGTCAGGATGG - Exonic
1110326963 13:74227582-74227604 AAGAGTTAAACCTTTAAGCAAGG - Intergenic
1119047889 14:71336985-71337007 GGGAGTCAAACGGGTCAGAAAGG - Intronic
1120528776 14:85607888-85607910 AGGAGTTCAAGCTGTCGGCAGGG + Intronic
1120856954 14:89220902-89220924 GGGAGGCAACCCTGACAGCAAGG + Intronic
1121411999 14:93754611-93754633 GGGAATTAAACTTCTCGGCAAGG + Intronic
1127918081 15:63471852-63471874 GGGACTTCATCCTGTAAGCAGGG + Intergenic
1127980600 15:64032232-64032254 GGGAATTAAATCTGACAGAAGGG + Intronic
1128314719 15:66653417-66653439 GGTAGTTGAATCTGTGAGCAAGG + Intronic
1141178728 16:81738206-81738228 GGTAGTGACGCCTGTCAGCATGG + Intergenic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1149688208 17:58551061-58551083 GGGAGATGAACATGCCAGCAAGG - Intergenic
1152989877 18:353416-353438 TGGAGTTAAACCTTCCAGCCTGG - Intronic
1153197710 18:2619220-2619242 GGGAGTTAAACATGTACACAGGG + Intergenic
1153355250 18:4127127-4127149 CAGAGTTGAACCTGTAAGCAAGG + Intronic
1157717607 18:49899580-49899602 GGGATTGAAACCTGTCAGGCTGG - Intronic
1161456326 19:4371440-4371462 GGGATTTAAACATCTCAGCGGGG + Intronic
1164169642 19:22713911-22713933 GGGTGATAATCCTGTCAGCTGGG + Intergenic
926457709 2:13088751-13088773 GAGAGTTAAAGATGTCAGCATGG + Intergenic
928598048 2:32875481-32875503 TGGTGTCAAACCTGTTAGCATGG + Intergenic
929636699 2:43529836-43529858 AGTAGTTAAACATGTCATCATGG + Intronic
929970701 2:46572660-46572682 GGTATTTAAACATTTCAGCATGG - Intronic
931272421 2:60714760-60714782 GGGAGATCAGCCTTTCAGCAGGG + Intergenic
931990477 2:67785114-67785136 GGGAGTTAAAGCCTTCAGGATGG + Intergenic
932368122 2:71166202-71166224 GGGAGGTGAAGCTGTCATCAGGG - Intergenic
932381143 2:71284413-71284435 GGAAGTTAAACATTTCATCAGGG + Intronic
932774911 2:74522569-74522591 GCGATTTATACCTGTGAGCATGG + Exonic
936743460 2:115544500-115544522 AGGTTTTAAACCTGTCATCATGG + Intronic
937683624 2:124671051-124671073 GGGAGTTCAGCCTGTCGCCACGG + Intronic
938016484 2:127871592-127871614 GTGAATTAAAGCTGTCAGCATGG - Intronic
938687598 2:133755554-133755576 GGCTGTTAAACCTTTCAGCAGGG - Intergenic
939720221 2:145640666-145640688 GGGTGTTAAACATGTCAGACAGG - Intergenic
943574457 2:189614788-189614810 GAGAGATCAACCTGCCAGCAAGG + Intergenic
1169675192 20:8145135-8145157 GGGAGATAAAGGTGTCAGCAGGG + Intronic
1170576648 20:17667908-17667930 GTGAGAGAAAACTGTCAGCATGG - Intronic
1171991391 20:31699236-31699258 GGGTGTTCCACCTGTCTGCAGGG - Intronic
1172824292 20:37767396-37767418 GGGAGTTACCTCTGCCAGCATGG + Intronic
1172969547 20:38863355-38863377 GGGAGTTAAACCTGTCAGCAGGG - Intronic
1173666894 20:44769512-44769534 GAGACTCACACCTGTCAGCAGGG + Intronic
1182746965 22:32613487-32613509 TGGAGTTAATCCTGCCAACAAGG + Intronic
1182866762 22:33610970-33610992 GGGTGTTAAGCCTGTCAGGACGG + Intronic
1183716009 22:39534143-39534165 GGGAGTTAAGACTGGCAGCCTGG + Intergenic
1183716552 22:39536564-39536586 GGGAGTAACACCTGACAGCCTGG + Intergenic
950945459 3:16941148-16941170 GGGAGTTAAAGCTGTGAGTATGG - Intronic
951611614 3:24496466-24496488 GGTTGTTAATGCTGTCAGCAGGG - Intergenic
953575304 3:44108675-44108697 GGGAGGGAAAGCTGCCAGCATGG - Intergenic
956791183 3:72681156-72681178 GGGAGTCAAGCCGTTCAGCATGG - Intergenic
960702623 3:120451812-120451834 GGGAGTTAACCCTGTCAAAGAGG - Intergenic
964225902 3:154401434-154401456 GTGAGATGAAGCTGTCAGCAAGG - Intronic
965539955 3:169862098-169862120 GAGAAGTAAACCTGTCAGCCCGG + Intronic
981829070 4:148979470-148979492 GGGAGCTTAAGCTGTCACCAGGG + Intergenic
983296199 4:165872476-165872498 GGGTGTAAAACCTGGCAGGAGGG - Intergenic
988706227 5:33728401-33728423 GGGAGTCACACCTGCCACCAAGG - Intronic
989391425 5:40904829-40904851 TGGAGTTAAACCACTCAGGAGGG - Intergenic
989433525 5:41383086-41383108 TGAAGTTAAATATGTCAGCATGG - Intronic
991406519 5:66305648-66305670 GGGAGGTAAGCCTGAAAGCAGGG + Intergenic
992012304 5:72541161-72541183 TGGAGTTACACCTGATAGCAAGG + Intergenic
992257404 5:74934671-74934693 TGGACTAAAACGTGTCAGCACGG - Intergenic
997550114 5:134745242-134745264 GGGATTTCACCCTGTCAGCCAGG - Intronic
1002068666 5:176665373-176665395 CGGAGCTGAACCTGGCAGCATGG + Intergenic
1005373347 6:25157478-25157500 GAGAGTTAAATCTGTGAGGAAGG - Intergenic
1006778517 6:36615725-36615747 GGGTTTTAAACCTGTCAACATGG - Intergenic
1010539469 6:77073260-77073282 GGTAGTCACACCTGTCAACAAGG + Intergenic
1014278142 6:119410849-119410871 GGAACTTTAACCTGTCAGTAAGG + Intergenic
1018369890 6:163157922-163157944 AAGAGTTAAGCCTGTCAGCTTGG - Intronic
1019657380 7:2203085-2203107 GGGCATTATACCCGTCAGCAAGG - Intronic
1021402550 7:20226153-20226175 AGGAGGTAAACCTGACAGCAGGG - Intergenic
1024050959 7:45623155-45623177 GGGATTGAAACTTGTCAGCTGGG + Intronic
1028602721 7:92619682-92619704 GGAAGATAACCCTGTCATCATGG + Intronic
1035160529 7:156947218-156947240 GGGAATAAAAACTATCAGCAGGG + Intergenic
1038857603 8:31350336-31350358 GAGAGTTAAACCTATAAGGAAGG - Intergenic
1039476793 8:37843019-37843041 GGTACTTAAACCAGACAGCAGGG + Exonic
1039940139 8:42083301-42083323 GGGAGTTCACCGTGTCAGCCAGG - Intergenic
1043721227 8:83548451-83548473 GGGAATTATATCTGTCAGAAGGG - Intergenic
1044931617 8:97257560-97257582 GGGAGTTAGTCCTATCAGAAAGG + Intergenic
1047415918 8:124664232-124664254 GTAAGTTCAACCTGTCATCATGG + Intronic
1047807960 8:128379016-128379038 GGGAGTTAATCCTGACATCTAGG - Intergenic
1053833266 9:42107115-42107137 GAGAGTTAGACATGTCAGCCAGG - Intronic
1054597285 9:67080294-67080316 GAGAGTTAGACATGTCAGCCAGG + Intergenic
1055425436 9:76190875-76190897 GGAAGTTAAACCTATGATCATGG - Intronic
1058060546 9:100491271-100491293 GGGAGTGAAACCATCCAGCAGGG + Intronic
1059357233 9:113709440-113709462 GGGAGAGAGAACTGTCAGCAGGG + Intergenic
1061035971 9:128114584-128114606 GGGAGATGAAGCTGTCAGGATGG - Intergenic
1187778254 X:22788058-22788080 TGCAGTTAAACCTGTCACCCAGG - Intergenic
1189111574 X:38295822-38295844 AGAAGATAAACCTGTCATCAGGG - Intronic
1189433105 X:40967076-40967098 GGGTCTTAAACATGTCAGGAAGG - Intergenic
1190477216 X:50840112-50840134 GGGAGGGAAACCTGGCAGCAGGG - Intergenic
1192499353 X:71639310-71639332 GGAAGTTAAAACAGTAAGCAGGG - Intergenic
1193525898 X:82588731-82588753 GGAATTTAAAGCTGTCTGCATGG + Intergenic
1194850955 X:98868416-98868438 GGGAGTAAAACTTTTCATCAAGG + Intergenic
1198655442 X:138908702-138908724 GGGCGCTAATCCTTTCAGCAGGG + Intronic
1198921870 X:141738181-141738203 GGAAGTTAAAAATGTCAACATGG + Intergenic