ID: 1172975198

View in Genome Browser
Species Human (GRCh38)
Location 20:38900845-38900867
Sequence TATCAAGAGCAGGACATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172975193_1172975198 4 Left 1172975193 20:38900818-38900840 CCCCATTCATATCCTTATCTGTG 0: 1
1: 1
2: 2
3: 16
4: 254
Right 1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 181
1172975194_1172975198 3 Left 1172975194 20:38900819-38900841 CCCATTCATATCCTTATCTGTGT 0: 1
1: 0
2: 0
3: 24
4: 288
Right 1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 181
1172975196_1172975198 -8 Left 1172975196 20:38900830-38900852 CCTTATCTGTGTGATTATCAAGA 0: 1
1: 0
2: 4
3: 14
4: 223
Right 1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 181
1172975195_1172975198 2 Left 1172975195 20:38900820-38900842 CCATTCATATCCTTATCTGTGTG 0: 1
1: 1
2: 0
3: 27
4: 293
Right 1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172975198 Original CRISPR TATCAAGAGCAGGACATGAG AGG Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
903036232 1:20494381-20494403 GGTTAAGAGCAGGAGATGAGGGG + Intergenic
904269366 1:29339431-29339453 TTTCACAAGCAGGCCATGAGGGG + Intergenic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
909175350 1:72350499-72350521 CATCAAGAGAAGGAGAGGAGAGG - Intergenic
910471818 1:87561507-87561529 TAGCCAGTGCAGGCCATGAGTGG - Intergenic
910824958 1:91396982-91397004 TATCATGAACTGTACATGAGAGG + Intronic
913523244 1:119666126-119666148 TGTCAAGAGAAGGACAGCAGTGG + Intronic
913543046 1:119840222-119840244 AATCAGGAGCAGGTAATGAGTGG - Intergenic
915465858 1:156097561-156097583 TGCCATGGGCAGGACATGAGTGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
916747230 1:167693929-167693951 TTCCAAGAGCAGGCCATGATGGG + Intronic
917301662 1:173580961-173580983 TATAAAAAGCAGCACAGGAGAGG + Intronic
917662206 1:177187677-177187699 GTTCAAGAGCAGAACAAGAGCGG - Intronic
918014922 1:180624037-180624059 AATCCAGAGCAGGAATTGAGGGG - Intergenic
918719617 1:187836619-187836641 TGTCAAGAGGAGCACATCAGTGG - Intergenic
921092234 1:211855182-211855204 TATCAAGAGGAGCACGTCAGTGG - Intergenic
921356522 1:214289574-214289596 TGAGAAGAGCAGGAAATGAGAGG - Intronic
1063082641 10:2783021-2783043 AAGCAAGAGAAGAACATGAGTGG - Intergenic
1065701723 10:28432298-28432320 TTTCAAGAGAAGAACATGAATGG - Intergenic
1068046675 10:51895226-51895248 TAGCAAGAGCAGGACAGAACTGG + Intronic
1070726970 10:78798840-78798862 TGTCAAGAGGAAGACATGGGTGG + Intergenic
1071034974 10:81233788-81233810 TATCAAGGGCAGGACCTGGTGGG + Intergenic
1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG + Intergenic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1076825852 10:132967675-132967697 CATCAAGAGGAGCACATCAGTGG - Intergenic
1078719649 11:13872591-13872613 GAGGAAGAGGAGGACATGAGGGG - Intergenic
1081133107 11:39404572-39404594 TATCAAGATCTGGAGATGAAGGG - Intergenic
1081201338 11:40219710-40219732 TATCAGGGGCAGGGCATGAGGGG + Intronic
1083452926 11:62758179-62758201 CATAAAGAGCAGGGCATGATTGG - Intergenic
1083549193 11:63573675-63573697 TATCAACACTAGGACATGAATGG + Exonic
1086945625 11:92841274-92841296 TAGAAGGAGCAGGAAATGAGAGG + Intronic
1091379248 12:45449-45471 TATAAAGAGGAGGAAAGGAGAGG - Intergenic
1092114150 12:5986641-5986663 TGTCAAGGGCAGGACCAGAGGGG - Intronic
1092569960 12:9710659-9710681 CATCAAGAGGAGCACATCAGCGG + Intergenic
1093007566 12:14067260-14067282 ATTCATGAGCAGGACAGGAGAGG + Intergenic
1093299413 12:17436015-17436037 TATCATGAGAACAACATGAGGGG + Intergenic
1094179469 12:27576520-27576542 GTTCCAGAGCAGGAGATGAGGGG + Intronic
1095420309 12:42018149-42018171 TATCCAAACCTGGACATGAGTGG + Intergenic
1095420451 12:42018979-42019001 TATCCAAACCTGGACATGAGTGG - Intergenic
1101425153 12:104582159-104582181 TATTAAGAGGAGGACATGAGCGG - Intronic
1104085428 12:125470435-125470457 TATCAAGAGCAAGAAATAAAAGG - Intronic
1104470212 12:129024135-129024157 TATCTGGAGCAGGGCAAGAGTGG - Intergenic
1106011054 13:25823699-25823721 TTTCTATAGCAGGACATGTGTGG + Intronic
1108634615 13:52320299-52320321 TATCAAGAGCAATTCAAGAGAGG - Intergenic
1109075712 13:57832273-57832295 CATCAAGAGGAGCACATCAGTGG + Intergenic
1111522539 13:89425219-89425241 TAAAAAGATCAGGACATGAATGG - Intergenic
1112477599 13:99746733-99746755 TGTCAAGTGCATGACATGGGAGG - Intronic
1113866746 13:113531421-113531443 GATCAAGAGCAGCACACGCGTGG + Intronic
1113866760 13:113531531-113531553 GATCAAGAGCAGCACACGCGTGG + Intronic
1118433215 14:65743563-65743585 TCTCAAAAGCAGGGCATGATAGG - Exonic
1118468385 14:66052693-66052715 TATCAACAGCAGCAAATGATGGG - Intergenic
1118476702 14:66124160-66124182 TCTCAAGAACTGGACTTGAGGGG + Intergenic
1121108514 14:91296338-91296360 TGGCAAGAGCTGGACATGTGTGG - Intronic
1124018888 15:25902305-25902327 TATCAAGGGCGGTTCATGAGTGG + Intergenic
1124222238 15:27860996-27861018 TCTCAGGAGCAGGGCAAGAGTGG + Intronic
1125744090 15:41987392-41987414 GATGAAGGGCAGGTCATGAGAGG + Intronic
1126463567 15:48939329-48939351 TATGAAGGGCAGGCAATGAGAGG + Intronic
1127121608 15:55776883-55776905 TATCAAGAGCAGGGCTTGAAGGG + Intergenic
1127452861 15:59133724-59133746 AATCAAGAGCAGAGCATGAACGG - Exonic
1129099659 15:73248346-73248368 CTTCAATAGCAGGACATTAGAGG + Intronic
1129284741 15:74515368-74515390 TAGCAAGAGGAGGAGAGGAGGGG + Intergenic
1129694637 15:77733635-77733657 TAGCAACAGCAAGCCATGAGAGG - Intronic
1129952785 15:79606926-79606948 ACTCAAGAGCAGGACAGGGGAGG - Intergenic
1134249842 16:12566523-12566545 TCTGAAGAGCATGACAGGAGGGG + Intronic
1136553556 16:30994809-30994831 TAGGATGAGCAGGAGATGAGGGG - Intronic
1139469924 16:67172801-67172823 TAGCAAGACCAGGACAGGCGCGG + Intronic
1142630926 17:1225788-1225810 TATCAACAGCAGGAGAGAAGAGG + Intronic
1144735740 17:17554347-17554369 TCTCTAGAGTAGGACATGGGAGG - Intronic
1147442571 17:40456425-40456447 TGCCAAGAGAAGGACATGAGGGG - Intronic
1149389178 17:56172582-56172604 TCCCAAGAGCAGGACATGGGAGG + Intronic
1151192837 17:72411222-72411244 GATCGTGAGCAGGACATAAGAGG + Intergenic
1152051691 17:77984100-77984122 TATCAAAAGCAGGGCATAAATGG - Intergenic
1152702978 17:81828670-81828692 GCACAAGAGCAGGACCTGAGGGG + Intronic
1153181038 18:2433711-2433733 TTTCAAGAGCAGAACTTCAGTGG + Intergenic
1156887938 18:42157354-42157376 TATCAGGATCAAGAAATGAGAGG + Intergenic
1157646524 18:49279018-49279040 TATTAAGAACAGGGCATAAGAGG - Intronic
1159127040 18:64235777-64235799 TATCAAGCACAGGACTGGAGTGG + Intergenic
1162003982 19:7765422-7765444 ACTCTAGAGCAGGACAGGAGAGG + Intronic
1164422843 19:28112240-28112262 TATCATGAGAAGAGCATGAGGGG + Intergenic
926001585 2:9337788-9337810 TATCAAGAACAAAACATGAATGG - Intronic
927310415 2:21624756-21624778 GTTCCAGAGCAGGACAGGAGAGG - Intergenic
928160011 2:28914172-28914194 TATCTGGAGCAGTACATGACCGG + Exonic
929941254 2:46335732-46335754 TTTCATGAGCAGGGCGTGAGAGG - Intronic
930330878 2:49981543-49981565 TATCAAGAGCGGGAAAAGTGGGG - Intronic
930331962 2:49996385-49996407 AATCAAGAGGAGGACAGGAATGG + Intronic
931334815 2:61328857-61328879 CTTGAAGAGCAGGACTTGAGAGG - Intronic
934141696 2:89053336-89053358 CATGAAGAGAAGGAGATGAGGGG - Intergenic
934227547 2:90147210-90147232 CATGAAGAGAAGGAGATGAGGGG + Intergenic
936564457 2:113572137-113572159 TATAAAGAGGAGGAAAGGAGAGG + Intergenic
937135331 2:119546742-119546764 TAGCCAGAGCTGGAAATGAGTGG - Intronic
938722798 2:134081156-134081178 CATCAAGGGCAGGAGAAGAGAGG + Intergenic
941028906 2:160490410-160490432 ATGGAAGAGCAGGACATGAGTGG - Intronic
942110092 2:172673587-172673609 AGTCATGAGCAGGACAGGAGAGG - Intergenic
942489936 2:176480043-176480065 TTTCAAGAGGGGGACATGGGAGG - Intergenic
944054742 2:195511966-195511988 TATCAAAAACTAGACATGAGTGG - Intergenic
947694643 2:232174791-232174813 CCTCAAGATCAGGACAAGAGAGG - Intronic
948858535 2:240741865-240741887 TGTCAGGAGCTGGACACGAGTGG - Intronic
1170667600 20:18400240-18400262 TATAAAGAGCAGGACAAGGAAGG + Intronic
1170759286 20:19235603-19235625 TGTCAAGATCTGGACTTGAGGGG - Intronic
1172944683 20:38678025-38678047 TATCCAGAGCAGGTCATGTGGGG - Intergenic
1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG + Intronic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175124291 20:56739965-56739987 TATCAAGAACAAGACAGGTGGGG - Intergenic
1175184011 20:57167603-57167625 TATTAAGAGCAGGATAGTAGAGG - Intergenic
1177325999 21:19589406-19589428 TAACAAAAGCAGGAAAAGAGTGG - Intergenic
1177583497 21:23058888-23058910 TATCATGAGAAAGACTTGAGTGG + Intergenic
1178113914 21:29397776-29397798 TATGTAGAGCAGGACATGCCAGG - Intronic
1179680895 21:43020665-43020687 TCTCAAGAGCAGGACACGCCAGG - Intronic
1180639849 22:17289479-17289501 TATCAAGACCAGGACACAAATGG - Intergenic
1184176502 22:42792306-42792328 TGTCAGGACCAGGACAGGAGTGG + Intergenic
1185150630 22:49161787-49161809 TCTCAGCAGCAGGACATCAGAGG - Intergenic
949843767 3:8350160-8350182 GACCAACAGCAGGACATGGGCGG - Intergenic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950647554 3:14386374-14386396 TGTCAAGAGCAGAAGCTGAGAGG + Intergenic
953729858 3:45438082-45438104 TGTGATGAGAAGGACATGAGAGG + Intronic
956275692 3:67498709-67498731 TATCAAGAAAAGGACAATAGGGG - Intronic
960424702 3:117492326-117492348 TATCATGAGAACCACATGAGGGG - Intergenic
961225869 3:125245283-125245305 TATCAGGAGAACGGCATGAGGGG - Intronic
963254188 3:143128444-143128466 TATGAAGTCCAGGACAAGAGAGG - Intergenic
963458855 3:145579814-145579836 TACCATGAGCAGGGCAGGAGAGG - Intergenic
965320988 3:167250955-167250977 TGTCAAGAGCAGTACATCAGCGG + Intronic
966705678 3:182911247-182911269 TTTCAATAGCAGGAGATGGGGGG - Intronic
969572542 4:8018170-8018192 TAACATGTGCAGGACAGGAGGGG - Intronic
971128112 4:23776436-23776458 ATTCCAGAGCAGAACATGAGAGG + Intronic
971219522 4:24692033-24692055 TATAAAGAGCAGCACAGGAGAGG + Intergenic
972031517 4:34465196-34465218 TGTCAAGGGCAGGACATGGTGGG + Intergenic
974100087 4:57406837-57406859 TGTCAAGGGCAGGACACGGGGGG - Intergenic
974430894 4:61794305-61794327 TCACAAGATAAGGACATGAGTGG + Intronic
981459245 4:144992768-144992790 AAGCAATAGCAGGACTTGAGAGG + Intronic
983075043 4:163316108-163316130 TGGCAAGAGCAGGACTTGTGGGG + Intergenic
984123933 4:175781615-175781637 TTTCAAGTGCAGGAAATCAGAGG - Intronic
984892964 4:184509698-184509720 TATGAATAGCAGGAGATGGGTGG - Intergenic
984961553 4:185102520-185102542 TTTCAAGAACAGCACATGAAGGG + Intergenic
985037314 4:185853518-185853540 TATAAAAAGGAGAACATGAGAGG + Intronic
989164891 5:38424212-38424234 TTTCAAGTGCAGGTCATCAGAGG - Intronic
991126799 5:63078876-63078898 TATCATGAGAAGAACAAGAGGGG - Intergenic
992093178 5:73337819-73337841 AACCAAGAGAAGGTCATGAGTGG - Intergenic
992463149 5:76981569-76981591 TAACAAGAGCAGAACATTATGGG + Intergenic
994487898 5:100402287-100402309 TATTAGGAGCAGCATATGAGAGG + Intergenic
997462912 5:134067042-134067064 AATCAAAAGCAGGAAAAGAGGGG - Intergenic
998584770 5:143415958-143415980 TATCAATAGCAAAACATGAGGGG - Intronic
998623945 5:143824298-143824320 AATCAAGAGCAGGAAATCATTGG + Intergenic
1001490391 5:172150754-172150776 GATCAAGAGCAGGGCATGGATGG - Intronic
1003069947 6:2938169-2938191 TATCGAGAGGAGTACATCAGTGG - Intergenic
1003243229 6:4362420-4362442 TATCAAGAGAATGACATGCCAGG - Intergenic
1003714900 6:8635423-8635445 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1005254806 6:23990057-23990079 TATAAAGAGCAGGAAGCGAGGGG - Intergenic
1005318556 6:24628890-24628912 TATCAAGAAGAGGTTATGAGAGG - Intronic
1009681786 6:66903072-66903094 TCTCAACAACAGGACATTAGAGG + Intergenic
1011190935 6:84727478-84727500 TATCATGAGAAGGAAATGGGTGG + Intronic
1013946437 6:115728265-115728287 CATCAAGAGAAGCACATGAGAGG + Intergenic
1014247283 6:119081942-119081964 TGTCAAGAGGAGCACATCAGTGG - Intronic
1014285939 6:119497819-119497841 TATCAAGTGCAGTTCATGAAAGG + Intergenic
1014379055 6:120715641-120715663 TGTCAAGAGCAGGACTAGTGTGG - Intergenic
1017681616 6:156870185-156870207 TAGCAAGGCCAGGTCATGAGTGG - Intronic
1021599854 7:22354726-22354748 TACCAAGGGAAGGCCATGAGAGG + Intronic
1021786225 7:24155413-24155435 TATTATGGGCAGGACATGAGGGG + Intergenic
1022256095 7:28659794-28659816 TATCAAGAGGAGGTTATGAGAGG - Intronic
1023089773 7:36607097-36607119 TGGCAAGAGCAGGAGAGGAGAGG + Intronic
1023855939 7:44184052-44184074 GATGAAGAGCAGGAGAGGAGAGG + Intronic
1026590522 7:71690995-71691017 TATCAGCAGCAGGATTTGAGAGG + Intronic
1026597014 7:71741649-71741671 TGTCAAGATCAGGGCTTGAGAGG + Intergenic
1027048762 7:75008282-75008304 TCTCAAGAGCAGGAGGGGAGGGG - Intronic
1027596501 7:80180868-80180890 AATGAAGACCAGGACATGAGAGG - Intronic
1029129931 7:98322238-98322260 TACCTAGAACAGGACATGATAGG - Intronic
1029384257 7:100233387-100233409 TCTCAAGAGCAGGAGGGGAGGGG + Intronic
1033709697 7:143929410-143929432 TATCAAGGGCATGAAATGAAAGG + Intergenic
1034065085 7:148128729-148128751 TTTCCAGATCAGGACATGAGTGG - Intronic
1034097012 7:148418854-148418876 TAACAAGAGCAGGAATTCAGAGG + Exonic
1035311079 7:157969485-157969507 CATCATGAGAAGGGCATGAGTGG + Intronic
1036044109 8:5120406-5120428 TATCAAGAGCAAGCCACGGGAGG + Intergenic
1036133498 8:6138128-6138150 TATCTAGAACAGGACAATAGCGG - Intergenic
1039585845 8:38706312-38706334 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1041150949 8:54933752-54933774 TATCATGAGCAGGATATATGAGG - Intergenic
1044475373 8:92619150-92619172 GAGCAAGAGCAGGACAGCAGGGG - Intergenic
1044910984 8:97058369-97058391 AACCAAGAGAAGGACATTAGAGG + Intronic
1046522275 8:115340559-115340581 TATTTAGAGCAGTACATGAAAGG - Intergenic
1047362931 8:124185395-124185417 TATCAAGGGGAGGACAGGTGGGG + Intergenic
1048103974 8:131387303-131387325 TATTAAGAAAAGTACATGAGTGG + Intergenic
1048920062 8:139220189-139220211 AATCAAAAGCAGGAAATTAGAGG + Intergenic
1049887964 9:41071-41093 TATAAAGAGGAGGAAAGGAGAGG - Intergenic
1050259382 9:3825570-3825592 TAAAAAGACCAGGACATGAAAGG + Intronic
1050579207 9:7033176-7033198 TGTCAAGACCAGGTGATGAGAGG + Intronic
1051137262 9:13936351-13936373 AATCAAGGGAATGACATGAGCGG - Intergenic
1051273873 9:15380772-15380794 TATCAAAAGCCAGACAGGAGGGG - Intergenic
1052134925 9:24897893-24897915 TGTCAAGAGAAGCACATCAGCGG + Intergenic
1056305400 9:85285851-85285873 TATGAAAAGCAGGAGCTGAGGGG + Intergenic
1059065899 9:111083375-111083397 TTTCAAGAGCAGGCCTTGATAGG + Intergenic
1061217668 9:129231264-129231286 TATCAAGAGCAGAACAGCACTGG - Intergenic
1186505404 X:10087602-10087624 TATCAACAGCAAGACCTGTGTGG - Intronic
1188676997 X:32953756-32953778 TATCATGAGAAAGACATGTGCGG + Intronic
1194580335 X:95664094-95664116 CATCAAGAGAAGAATATGAGGGG - Intergenic
1198481843 X:137048272-137048294 TATCATGAGAGGCACATGAGGGG + Intergenic
1199894440 X:152117440-152117462 TATCATGAGCAGGGCCTCAGGGG - Intergenic