ID: 1172976248

View in Genome Browser
Species Human (GRCh38)
Location 20:38908068-38908090
Sequence CTGTATAGGAAGGAGTATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172976242_1172976248 -4 Left 1172976242 20:38908049-38908071 CCTGTCGGACAGGACCAACCTGT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG 0: 1
1: 0
2: 2
3: 18
4: 259
1172976238_1172976248 25 Left 1172976238 20:38908020-38908042 CCTCTCAGGAAGGTGGTGCGGCG 0: 1
1: 0
2: 1
3: 2
4: 88
Right 1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG 0: 1
1: 0
2: 2
3: 18
4: 259
1172976241_1172976248 0 Left 1172976241 20:38908045-38908067 CCAGCCTGTCGGACAGGACCAAC 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG 0: 1
1: 0
2: 2
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172976248 Original CRISPR CTGTATAGGAAGGAGTATGA GGG Exonic
901597662 1:10398465-10398487 ATGTATTGGTTGGAGTATGATGG - Intergenic
901863525 1:12089517-12089539 TTGTATAGGAGGAAGTATGTGGG + Intronic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
903366048 1:22805980-22806002 CTGGACAGGATGGAGTGTGAGGG - Intronic
906005654 1:42467462-42467484 ATGAATAGGAAGGAGGATCAAGG + Intronic
906837548 1:49100281-49100303 TCATATAGGAAGGAGTATAAAGG - Intronic
907281790 1:53352068-53352090 CTGACCAGGAAGGAGCATGAGGG - Intergenic
907281925 1:53353706-53353728 CTGACCAGGAAGGAGCATGAGGG - Intergenic
907485922 1:54778055-54778077 CTGTATAGGAAGCATGATGCTGG - Intergenic
908082969 1:60600321-60600343 CTGTACAGGAAGCATGATGATGG + Intergenic
908324712 1:63012503-63012525 CAGCATAGGAAAGAGTGTGATGG + Intergenic
912810092 1:112787535-112787557 CTGTATAGGAAGCATGATGCTGG + Intergenic
912838420 1:113017414-113017436 CTCTATAGGAAGGAGGAAGGGGG - Intergenic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
913976860 1:143466296-143466318 CTTTATTAGAAGGAGAATGAAGG - Intergenic
914071262 1:144291923-144291945 CTTTATTAGAAGGAGAATGAAGG - Intergenic
914107893 1:144674432-144674454 CTTTATTAGAAGGAGAATGAAGG + Intergenic
915989553 1:160500078-160500100 GTGAATAGGAGGGAGTATAAAGG + Intronic
916176147 1:162040629-162040651 CAGTAGAGGAAGGAGTAGCATGG + Intergenic
916248385 1:162710841-162710863 CTGGAAAGGCTGGAGTATGAAGG - Intronic
916254351 1:162771360-162771382 TTTTATAGGAAGGAGCCTGAAGG + Intronic
917440485 1:175064440-175064462 GTGCATAGGAAGGGGCATGATGG + Intergenic
917745922 1:178007113-178007135 TTATATAGGAAGAAGAATGAAGG + Intergenic
918683342 1:187383109-187383131 CTGTATAGGAAAAAATGTGAAGG + Intergenic
919472426 1:197996022-197996044 CTGGACAGGATGGAGCATGAGGG + Intergenic
919584539 1:199419787-199419809 CTTTATAGAAAACAGTATGAAGG + Intergenic
919854051 1:201693757-201693779 CTGAATGGGCAGGAGTATGTGGG + Intronic
923072014 1:230574351-230574373 CTCTAAAGGCAGGAGAATGATGG - Intergenic
923708306 1:236363807-236363829 CTGTATAGGAAACACAATGATGG - Intronic
1063505608 10:6595566-6595588 TTGTATAGGACGGACTATGGGGG - Intergenic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1065687906 10:28303865-28303887 CATGATAGGAAGGAGTATGGGGG - Intronic
1068508357 10:57931413-57931435 CATTATGGGAAGCAGTATGAGGG + Intergenic
1070635673 10:78125304-78125326 CTGTATAGGAAGCATAATGCTGG + Intergenic
1071513850 10:86284101-86284123 GTGTATATGCAGGCGTATGAGGG - Intronic
1071573317 10:86709744-86709766 CTGTGAAGGAAGGACCATGAGGG - Intronic
1078648670 11:13166821-13166843 CTGTATTGAAAGGATTAAGAGGG - Intergenic
1080881841 11:36328563-36328585 CTGTATAGGAAGCATGATGTTGG - Intronic
1082644814 11:55709523-55709545 CTGTACAGGAAGCATGATGATGG - Intergenic
1083727014 11:64633967-64633989 GTGTGAAGGAAGGAGCATGAGGG - Intronic
1084398798 11:68931855-68931877 TTGTGTAGGAGGGAGTAGGATGG + Intronic
1084423396 11:69071710-69071732 CCGCACAGGAAGGAGTCTGACGG - Intronic
1084968822 11:72758396-72758418 CTGTACAGGAAGGAAACTGAGGG + Intronic
1088300185 11:108349948-108349970 CTGGAGAGGAAGGAGTATGAGGG + Intronic
1089083941 11:115800917-115800939 CTGCATAGAAAGGACAATGACGG - Intergenic
1090468422 11:126956293-126956315 CTCCATGGGAAGGAGTAAGAAGG - Intronic
1091196545 11:133736267-133736289 CTGTACAGGAAGCAGAGTGAGGG + Intergenic
1092321977 12:7486002-7486024 ATGTATACAAAGCAGTATGAGGG + Intronic
1095226840 12:39687355-39687377 CTGTATAGGAAGCAGGATTCTGG + Intronic
1095345373 12:41143300-41143322 CTGTATTGGAATGAGAAGGATGG + Intergenic
1095423757 12:42052681-42052703 CTGTATAGGAAGCATAATGCTGG - Intergenic
1095432645 12:42150496-42150518 CTGTATAGAAAGGAATATGAGGG - Intergenic
1098406608 12:70133074-70133096 CTCTGTAGAAAGCAGTATGAAGG - Intergenic
1100709055 12:97234742-97234764 CTGTATAGGAAGCACAATGCTGG + Intergenic
1101624170 12:106422384-106422406 CTGTATAGGAAGCATGATGCTGG - Intronic
1103354816 12:120311979-120312001 GTGTATAGGAAGGAAATTGATGG + Intronic
1105222369 13:18343513-18343535 CTTTATTAGAAGGAGAATGAAGG + Intergenic
1105383545 13:19909866-19909888 ATGTGTAGGAATGAATATGAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107495172 13:40919354-40919376 CTGGCTGGGAAGGAGCATGAAGG + Intergenic
1108583276 13:51845476-51845498 CTGCTTAGGAAAGAGTGTGAAGG + Intergenic
1110352013 13:74519984-74520006 CTGTATAGGAAGCATGATGCTGG + Intergenic
1110901694 13:80833189-80833211 CTGTATAGGAAGCATGATGCTGG + Intergenic
1111463524 13:88577013-88577035 CTGTATAGGAAGCATGATGCTGG + Intergenic
1112681076 13:101765560-101765582 CTATAAAGGAAAGAGTAGGAAGG - Intronic
1112755335 13:102626091-102626113 CTGATTAGGAAGGGGCATGATGG - Intronic
1115445427 14:33484269-33484291 CTATGTAGGAAGCACTATGAGGG + Intronic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1119448407 14:74686318-74686340 CTGTCAAGGTAGGAGTCTGAGGG + Intronic
1119561136 14:75590793-75590815 CTGTATAGGAAGCATGATGCTGG - Intronic
1120139322 14:80910586-80910608 CTGTATAGGAAGCATGATGTTGG - Intronic
1120329371 14:83070324-83070346 CAGTATAGAAAAAAGTATGAAGG - Intergenic
1122527022 14:102394147-102394169 GTGGAAAGGAAGGAGAATGAGGG - Intronic
1124216229 15:27808934-27808956 GTGAAGAGGAAGGAGAATGATGG - Intronic
1124842917 15:33261269-33261291 CTGTATAGGAAGCATGATGCTGG - Intergenic
1125301847 15:38263143-38263165 ATGTGAAGGAAGGAGTAGGAAGG + Intronic
1125451951 15:39817805-39817827 CTGTGGAGCAGGGAGTATGACGG + Intronic
1127750207 15:62030473-62030495 CTGTATAGGAAGCATGATGCCGG - Intronic
1127968513 15:63941769-63941791 CTGTACAGAAAGGAGCATGAGGG + Intronic
1132206328 15:99988432-99988454 CTGTATAGGAAGCACCATGCTGG - Intronic
1134010054 16:10845272-10845294 CTGTATAGAAAGCAGAATGATGG - Intergenic
1137025039 16:35465521-35465543 CATTCTAGGAAAGAGTATGAAGG - Intergenic
1137284587 16:47004636-47004658 ATGTAAAGGAAGCAGGATGAGGG - Intergenic
1137346347 16:47665611-47665633 GTGTATAGGAGGGATTAAGAGGG - Intronic
1138978905 16:62242479-62242501 CTGTATAGGAAGCATGATGCTGG - Intergenic
1141344526 16:83232691-83232713 CTGTATAGGAAGCATGATGCTGG - Intronic
1144720393 17:17465325-17465347 CGGTAGAGAAAAGAGTATGAAGG + Intergenic
1145112829 17:20179368-20179390 CTGCAAAGCAAGGACTATGATGG - Intronic
1149456242 17:56790975-56790997 CTGTACAGGAAGCATGATGATGG - Intergenic
1151095357 17:71491184-71491206 CAGTATTGGAAGGACTCTGATGG - Intergenic
1152029612 17:77833990-77834012 CTGTGTGGGAAGGAGTGTGGTGG + Intergenic
1152370872 17:79887865-79887887 CTGTATTGGAAGGAGCAGGATGG - Intergenic
1154251792 18:12750964-12750986 CTGGCTGGGAAGGAGGATGAAGG - Intergenic
1155424964 18:25697348-25697370 CTGTGTAGGAAGGAGAAACATGG + Intergenic
1156046681 18:32885289-32885311 CTGTATAGGAAGCATAATGCCGG - Intergenic
1156658793 18:39320741-39320763 TTGTATGGAAAGGAGTATGCAGG - Intergenic
1156848572 18:41698936-41698958 CTCTATACAAAGGACTATGAGGG - Intergenic
1157186970 18:45549049-45549071 CAGCATAGGAAGGAGGATGGAGG - Intronic
1157392909 18:47317765-47317787 CTGGATTGTAAGCAGTATGAGGG - Intergenic
1157831101 18:50857752-50857774 ATTTATAGGTAGGAGGATGATGG - Intergenic
1158038665 18:53066813-53066835 CTGTATAGGAAGCATGATGCTGG + Intronic
1159096325 18:63906390-63906412 CTGTATAGGAAGCATAGTGATGG - Intronic
1159509557 18:69378784-69378806 GACTATAGGAATGAGTATGAGGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160292667 18:77608863-77608885 CGCTATAGGAAACAGTATGAGGG - Intergenic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1164527667 19:29023668-29023690 CTCTAAGGGAAGGAGTGTGAGGG - Intergenic
1165602502 19:37067154-37067176 ATGACTAGGAAGGAGCATGAAGG + Intronic
1166181272 19:41110843-41110865 TTGACTAGGAAGGAGTAGGAAGG + Intergenic
1166206545 19:41273394-41273416 CTGTACAGGAACGAGGAAGAAGG - Intronic
1166456229 19:42942309-42942331 TTGTACAGGATGGACTATGAAGG + Intronic
1166483286 19:43191597-43191619 CTGTACAGGATGGAACATGAAGG + Intronic
925854675 2:8118051-8118073 CAGAATTGGAAGGAGAATGATGG - Intergenic
926248465 2:11138846-11138868 CTGTACAGGAAGCAGGATGCTGG - Intronic
927716541 2:25356788-25356810 CTTTATAGGAAGCATGATGATGG - Intergenic
928396490 2:30946570-30946592 CTGTATAGGAAGCATGATGCTGG - Intronic
928537676 2:32256099-32256121 TTGATAAGGAAGGAGTATGATGG - Intronic
928566751 2:32560376-32560398 CTTCATATCAAGGAGTATGAAGG - Intronic
931589160 2:63862437-63862459 CTGTACACGAAGGAATGTGAAGG - Intronic
932271468 2:70413751-70413773 CTCTATAGGCAGGAGAATTAGGG - Intergenic
932903582 2:75726363-75726385 CTGTATAGGAAGCATGATGGTGG + Intergenic
933426211 2:82115010-82115032 CTGTACAGGAAGGCTTATGGTGG + Intergenic
933698744 2:85239239-85239261 CTGCATAGGAAGGAGCATACAGG - Intronic
934181561 2:89627280-89627302 CTTTATTAGAAGGAGAATGAAGG - Intergenic
934291864 2:91701500-91701522 CTTTATTAGAAGGAGAATGAAGG - Intergenic
935158401 2:100505531-100505553 CTGTATAGGAAGCATGATGCTGG - Intergenic
935801955 2:106706825-106706847 CTGTATCAGGAGGAATATGACGG + Intergenic
935823872 2:106922205-106922227 CACTGTAGGAAAGAGTATGAGGG - Intergenic
936649283 2:114407760-114407782 CTGTGGATGAAGGATTATGAAGG - Intergenic
937146096 2:119646173-119646195 ATGTCTAAGAAGGAGTATAAAGG + Intronic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
939778705 2:146417569-146417591 CTGTATAGGAAGCATGATGCTGG - Intergenic
941802445 2:169675373-169675395 CTGTACAGGAAGGATGATGCTGG + Intronic
941924675 2:170883371-170883393 CTGAAGAGAAAGGAGAATGAAGG + Intergenic
942572375 2:177327286-177327308 ATATAAAGGTAGGAGTATGAAGG + Intronic
944301855 2:198132590-198132612 CTGGATAGGAAGGATTAGGGAGG + Intronic
944594681 2:201250405-201250427 CTGTATAGGAAGCATGATGCTGG + Intronic
944876758 2:203970111-203970133 ATGTATAGCAAGCACTATGAAGG - Intergenic
945215066 2:207424577-207424599 ATGGCTAGGAAGGAGTATAAGGG - Intergenic
945644321 2:212470209-212470231 CTTTATTTGAAGCAGTATGAGGG - Intronic
945956105 2:216087370-216087392 GTTTAGAGGAAGTAGTATGAAGG + Intronic
946201919 2:218075550-218075572 CTGTAGAGGGAGCAGTATCAGGG + Exonic
946526221 2:220523592-220523614 CTGTATAGGAAGCATAATGCTGG - Intergenic
946890033 2:224265676-224265698 GTGTATAGGAAGGAGTGGGTTGG + Intergenic
1169662712 20:7998094-7998116 CTGTACAGGAAGGATGATGCTGG - Intronic
1170714327 20:18818860-18818882 CTGTATAGGAAGCATGATGCTGG + Intronic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173270901 20:41533915-41533937 CTGTATAGGAGGAAGTTTTATGG + Intronic
1175234026 20:57496333-57496355 CTGTACAGGAAGGATGATGTTGG - Exonic
1175878500 20:62242933-62242955 CTGTAGAGGAAGGAGGACTATGG + Intronic
1176730917 21:10495937-10495959 CTTTATTAGAAGGAGAATGAAGG + Intergenic
1177021534 21:15865363-15865385 GTGTATAGCAAAGAATATGAGGG + Intronic
1177319429 21:19501034-19501056 CTGTACAGGAAGCATTATGCTGG + Intergenic
1177608599 21:23415971-23415993 CTGGAGAGGAAGGAATAGGAAGG + Intergenic
1177890863 21:26802551-26802573 CTGTATAGGAAGGGGTGAGATGG + Intergenic
1178961644 21:37072006-37072028 CTGATTAGGAAAGAGTAAGAGGG - Intronic
1179146854 21:38775520-38775542 CTGTATTGGAATGGGGATGAGGG + Intergenic
1179585026 21:42369358-42369380 CTGTCTAGGAAGGAGGAAGCAGG + Intergenic
1180499201 22:15917559-15917581 CTGTATAGGAAGCATAATGCTGG + Intergenic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
951937177 3:28034351-28034373 CTGTATAGGAAGCATGATGCTGG - Intergenic
952023165 3:29047663-29047685 CTATATAGGTATGTGTATGAAGG - Intergenic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952866625 3:37859864-37859886 CTGTATTGGGAGGATTAAGAAGG + Intergenic
955512597 3:59696508-59696530 CTGTATAGGAAGCATAATGCAGG + Intergenic
958129861 3:89404483-89404505 CTGTGTAGGATGGAGTAAAATGG + Intronic
958778054 3:98509428-98509450 ATGCATAGGAGGGAGTAAGAGGG + Intronic
960011578 3:112840054-112840076 ATGTATAGGAATGAATATTAAGG + Intronic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
960444502 3:117731187-117731209 CTGTAGAGAAATGAATATGATGG + Intergenic
968650091 4:1757018-1757040 CTGTCCAGGAAGGAGTCTGAGGG + Intergenic
969156948 4:5219319-5219341 CTCTACAGGAAGGAGTTGGAAGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969634965 4:8363463-8363485 CTTAATAGGCAGGAGTATCATGG + Intergenic
969836228 4:9844183-9844205 CTGTAAAGAAAGGAGTCAGAAGG - Intronic
970739966 4:19224399-19224421 CTCTATGGAAAGCAGTATGAAGG - Intergenic
970858528 4:20675799-20675821 CTGTATTTGAAGTACTATGATGG + Intergenic
971055034 4:22902965-22902987 CTGTACAGGAAGGAAGATGCTGG + Intergenic
971425761 4:26513718-26513740 CTCTATGGGAAATAGTATGAAGG - Intergenic
971455381 4:26839507-26839529 ATGTGTGGGAAGGAGCATGAGGG + Intergenic
974195583 4:58570381-58570403 CTTTATAGGAAGGAGTCTCTAGG + Intergenic
975885879 4:78964110-78964132 GTGCATGGGAAGGAGTAAGAAGG - Intergenic
975943553 4:79677324-79677346 CTGTATAGGATGGAGTGGGTTGG - Intergenic
976456067 4:85247858-85247880 TTATATAGGAAGAAGAATGAAGG - Intergenic
976540857 4:86273708-86273730 TTTAATAGAAAGGAGTATGAGGG - Intronic
977511105 4:97964041-97964063 GTGAATAGGAAGGACTATGATGG + Intronic
980597667 4:134975914-134975936 CACCAAAGGAAGGAGTATGAAGG - Intergenic
982505906 4:156217888-156217910 CTGTAAAGGAAGCACAATGATGG - Intergenic
982568747 4:157021777-157021799 CTGTATAGGAAGCATGATGCTGG + Intergenic
982909821 4:161125915-161125937 CATTATAGAAATGAGTATGAAGG + Intergenic
983298252 4:165893216-165893238 CTGTACAGGATGGAGTAACAGGG + Intronic
984691251 4:182728373-182728395 ATCTATTGGTAGGAGTATGAAGG - Intronic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986903020 5:12460336-12460358 ATGTATAAGAAGGGGTTTGAAGG + Intergenic
987136771 5:14907040-14907062 CTGTACAGGAAGGATGATGTTGG - Intergenic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
987393246 5:17396935-17396957 CTGTATAGGAAGCACAATGCTGG + Intergenic
988608758 5:32705433-32705455 CTGTACAGGAAGCAGGATGATGG + Intronic
988671448 5:33386109-33386131 CTGTATAGGAAGCATGATGCTGG + Intergenic
988680725 5:33481266-33481288 ATGAAGAGGAAGGAGAATGAAGG - Intergenic
991633431 5:68679893-68679915 CTGTATAGGAAGGACTCCCAAGG - Intergenic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
992303879 5:75414255-75414277 TGGAATAGGAAGGAGCATGAAGG + Intronic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994874318 5:105396476-105396498 CAGGTTAGGAAGGAGTATGATGG - Intergenic
995410955 5:111856493-111856515 CTGTGTTCGAAGCAGTATGATGG + Intronic
995561691 5:113388677-113388699 CTGTATAGGAAGTATGATGTTGG - Intronic
996235972 5:121129141-121129163 CTGTACAGGAAGCATGATGATGG - Intergenic
998810004 5:145956753-145956775 CTGTAAAGAAAGGATTGTGAAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003466788 6:6388085-6388107 CTATATAGAAAACAGTATGAAGG + Intergenic
1003986847 6:11443976-11443998 CTGTATAGGAAGCATGATGTTGG + Intergenic
1004212604 6:13665976-13665998 CTAACTAGGAAGGAGCATGAGGG + Intronic
1005522273 6:26611804-26611826 CTGTATATGTAGGAGAATTAAGG + Intergenic
1005783960 6:29222972-29222994 GTGTAGAAGAAGGAGAATGAAGG - Intergenic
1006353117 6:33535818-33535840 GGGTAAAGGAAGGAGGATGAAGG + Intergenic
1006592212 6:35166690-35166712 CTGTGCAGGAAGGAGCCTGATGG + Intergenic
1007094296 6:39203865-39203887 CTGTCTAAAAAGGAGTATGCAGG + Intronic
1007326037 6:41060424-41060446 CAGTAAAGGAAGTATTATGAAGG - Intronic
1008625584 6:53312857-53312879 CTGTAAAGGAAGGTTTATGTTGG + Intronic
1010003353 6:70970264-70970286 CTGTATAAGAAGCAGTGTGCCGG + Intergenic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1012230747 6:96758438-96758460 CTGTATAGGAAGCATGATGCTGG - Intergenic
1013589500 6:111608246-111608268 CTGTACAGGATGGAACATGAAGG - Intergenic
1014136224 6:117893143-117893165 CAGAATAGGATGTAGTATGAAGG + Intergenic
1015440749 6:133242828-133242850 CTTCATAGGAAGGAGAAAGAGGG - Intronic
1017995419 6:159527857-159527879 CTGCAGAGGTAGGAGCATGAGGG - Intergenic
1018297692 6:162366952-162366974 CTGTATACAAAAGAGTATGAGGG - Intronic
1018996622 6:168715163-168715185 CATAATAGGAAGGAGAATGATGG + Intergenic
1020527573 7:9282088-9282110 CTGTATAGGAAGCAGGATGCTGG + Intergenic
1021229784 7:18072340-18072362 CTGTCTAGGAATTAGTTTGATGG + Intergenic
1021758750 7:23882525-23882547 CTGTATAGGAAGCATGATGCTGG + Intergenic
1022488532 7:30799154-30799176 CTGTAAATGAAGGGGTAGGATGG + Intronic
1023021786 7:36017730-36017752 CTGTACAGGATGGAACATGAAGG + Intergenic
1024355527 7:48410332-48410354 CTGTAGAGGAAAGAGTTTCAGGG + Intronic
1028310472 7:89327008-89327030 CAATATATGAATGAGTATGAAGG - Intronic
1031008015 7:116496826-116496848 CTGTACAGGAAGCATTATGATGG + Intronic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1033658009 7:143386318-143386340 GTGGATAGGAAGGACGATGAGGG + Intronic
1034270007 7:149798814-149798836 CTGGAGAGGAAGGAGGGTGAGGG + Intergenic
1035921765 8:3684792-3684814 ATCTATAGCAAGGAGAATGAGGG - Intronic
1036125358 8:6057233-6057255 CAGCATAGGAAAGACTATGAGGG - Intergenic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1037233845 8:16693392-16693414 CATTATAGAAAGCAGTATGAAGG + Intergenic
1038127838 8:24693985-24694007 CTCTATAGGATGGATTATAAAGG + Intergenic
1039403008 8:37287534-37287556 CTGTACAGGAAGCATTATGCTGG - Intergenic
1042099379 8:65258066-65258088 TTGTCTAGTAAGGAGCATGAGGG - Intergenic
1042577918 8:70241368-70241390 CTTTAGAGGAAGGAGAATGAAGG - Intronic
1042984243 8:74565833-74565855 CTGTATAGGAAGCATGATGCAGG + Intergenic
1044074523 8:87802621-87802643 CTGGGTAGGATGGAGTAGGATGG + Intergenic
1045369337 8:101505853-101505875 TTGCTTAGGAAGGATTATGAAGG - Intronic
1048049910 8:130806908-130806930 CTGTCTCGGAAGGTGTATGTAGG - Intronic
1050166036 9:2765632-2765654 CTGTACAGGAAGCAGGATGTTGG + Intronic
1050432616 9:5577079-5577101 ATGTATAGGAAGGATTCTAATGG - Intergenic
1052311109 9:27070215-27070237 CTGGGTGGGAAGGAGTAGGATGG + Intergenic
1052556363 9:30023278-30023300 CTGTATAGGAAGCATGATGCTGG + Intergenic
1053529642 9:38867323-38867345 CACTATGGGAAGCAGTATGATGG + Intergenic
1054201867 9:62091750-62091772 CACTATGGGAAGCAGTATGATGG + Intergenic
1054636490 9:67496609-67496631 CACTATGGGAAGCAGTATGATGG - Intergenic
1056231769 9:84553435-84553457 CTTTCTAGGAAGAAGTATTATGG - Intergenic
1057305886 9:93911794-93911816 CTGAATAGGCAAGACTATGACGG + Intergenic
1057686675 9:97240784-97240806 CTGGCTGGGAAGGAGCATGAAGG - Intergenic
1060421684 9:123473637-123473659 TTGTGTAGGAAGCAGTATGAGGG + Intronic
1187309093 X:18123362-18123384 CTTTGTAGGAAGGAAGATGATGG - Intergenic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1188045360 X:25420131-25420153 CTGTATAGGAAGCATGATGTTGG - Intergenic
1189025490 X:37389442-37389464 CTGTATAGGAAGCATAATGCTGG + Intronic
1189957536 X:46291152-46291174 CTGTACAGGAAGCATTATGCTGG + Intergenic
1191157274 X:57287232-57287254 ATGGATAGGAAGGACTATGACGG - Intronic
1192098107 X:68234641-68234663 CTGCTTAGAAAGGAGAATGAAGG + Intronic
1194023719 X:88725672-88725694 CTGTATAGGAAGCATGATGCTGG + Intergenic
1194084711 X:89511145-89511167 CTGTATAGGAAGCATGATGCTGG + Intergenic
1197077931 X:122375488-122375510 GTGTACAGGATGGAGCATGAAGG + Intergenic
1197338410 X:125235756-125235778 CTGTATAGGAAGCATGATGCTGG - Intergenic
1197578273 X:128250115-128250137 CTGTATAGGAAGCATGATGCTGG + Intergenic
1197775443 X:130115843-130115865 CTTTATAGGAAGGATTATAGGGG - Intergenic
1198305379 X:135377061-135377083 CTGTATAGGAAGCATGATGCTGG - Intergenic
1198480585 X:137036126-137036148 CTGTATAGGGAGATGTTTGAGGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1200437357 Y:3167032-3167054 CTGTATAGGAAGCATGATGCTGG + Intergenic