ID: 1172976298

View in Genome Browser
Species Human (GRCh38)
Location 20:38908358-38908380
Sequence CACCATCAGACTGAATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172976298_1172976306 21 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976306 20:38908402-38908424 GTGATCGGGGAGTGTGTTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 114
1172976298_1172976304 7 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG 0: 1
1: 0
2: 2
3: 12
4: 127
1172976298_1172976301 -4 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976301 20:38908377-38908399 GGTGGTGGCTGCTGTAGTTAAGG 0: 1
1: 0
2: 6
3: 64
4: 440
1172976298_1172976305 8 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976305 20:38908389-38908411 TGTAGTTAAGGAGGTGATCGGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1172976298_1172976307 30 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976307 20:38908411-38908433 GAGTGTGTTAGAGGCTGAGCTGG 0: 1
1: 0
2: 1
3: 30
4: 265
1172976298_1172976302 -1 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976302 20:38908380-38908402 GGTGGCTGCTGTAGTTAAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 176
1172976298_1172976303 6 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976303 20:38908387-38908409 GCTGTAGTTAAGGAGGTGATCGG 0: 1
1: 0
2: 0
3: 21
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172976298 Original CRISPR CACCATCAGACTGAATCTGC TGG (reversed) Intronic
900212003 1:1460743-1460765 CAGGATCAGCATGAATCTGCGGG - Exonic
901600117 1:10417063-10417085 CACCATCAAACTGGAACTTCTGG - Exonic
906050668 1:42868705-42868727 CTCCATCATACTGAATCAGCTGG + Intergenic
906999724 1:50838198-50838220 CACCATCTGATGGTATCTGCAGG - Intronic
907390888 1:54157587-54157609 CTCTACCAGACAGAATCTGCTGG - Intronic
909395204 1:75163954-75163976 CCTCACCAGACAGAATCTGCTGG + Intergenic
911786955 1:101963107-101963129 CACCTTCAGATTCATTCTGCTGG + Intronic
911786957 1:101963109-101963131 CCCCAGCAGAATGAATCTGAAGG - Intronic
914923353 1:151862477-151862499 AACCCTCAGACTGAATCTGGAGG + Intergenic
915534443 1:156526572-156526594 CACCCTCATACTGGAGCTGCAGG + Exonic
917959581 1:180131739-180131761 CACCATTCCACTGAAACTGCTGG - Intergenic
1065072133 10:22036048-22036070 CACCATCATCCTGAAGCAGCTGG + Intergenic
1069891381 10:71654628-71654650 CACCATCAGAATGGATCCTCCGG - Intronic
1072123345 10:92423470-92423492 CACCAGAAAACTGAACCTGCTGG + Intergenic
1076588715 10:131568986-131569008 CACCATGAGGCTGAATCCCCGGG + Intergenic
1079005453 11:16788672-16788694 CACCCTCACACAGCATCTGCTGG + Exonic
1082691258 11:56307817-56307839 CACCATTACACTGCAGCTGCTGG - Intergenic
1082896062 11:58191165-58191187 CTCCAGCAGAGTGGATCTGCAGG - Exonic
1084934871 11:72581464-72581486 CACCATCAAACAGAACCTGGGGG + Exonic
1090908436 11:131097226-131097248 CACCACCAGAGTGAATTTACAGG - Intergenic
1093752990 12:22821835-22821857 CACCATCATCCTGAAGCAGCTGG + Intergenic
1093980645 12:25471712-25471734 CAACATCAGATGGGATCTGCTGG - Intronic
1094592933 12:31838195-31838217 CCTCACCAGACAGAATCTGCTGG - Intergenic
1095611084 12:44128743-44128765 CACAATCAGCTTAAATCTGCTGG - Intronic
1100817780 12:98402468-98402490 AACCATCAGACTGAGCCTTCGGG + Intergenic
1100959430 12:99946034-99946056 CACCACCAGAGTGGATCTGGGGG - Intronic
1104740178 12:131166141-131166163 CAAGATCAGATTTAATCTGCAGG + Intergenic
1114264354 14:21063647-21063669 CTCCAGAAGACTGACTCTGCTGG + Intronic
1115705798 14:35996951-35996973 CAACATCATAATGAATCTGGAGG - Intergenic
1119994924 14:79242737-79242759 CTCCATCAGTCAGATTCTGCTGG + Intronic
1121957767 14:98229551-98229573 CTCCATCAGCCTGAGTCTTCAGG - Intergenic
1121968045 14:98328789-98328811 CCTCATCAGACTGAATCGGCCGG - Intergenic
1122025770 14:98874733-98874755 CAGCCTCAGACTGACCCTGCAGG + Intergenic
1123764986 15:23469230-23469252 CAGCATGAGTCTGAGTCTGCAGG + Intergenic
1127596267 15:60485596-60485618 AGCCATCAGTGTGAATCTGCTGG + Intergenic
1130804158 15:87301119-87301141 CTCCACCACACTGAATCTTCTGG - Intergenic
1132533273 16:464241-464263 CCCCATCAGCCTCAACCTGCTGG - Intronic
1132682902 16:1150937-1150959 CCCCATAAGACGGAAGCTGCAGG + Intergenic
1133269206 16:4602383-4602405 CACCAGGAGGCTGAACCTGCTGG + Intergenic
1133930519 16:10228511-10228533 CAGCCTCAGCCTGATTCTGCAGG - Intergenic
1138281735 16:55777202-55777224 CACCATCATGCTGAATTTGGGGG + Intergenic
1138287139 16:55819212-55819234 CACCATCATCCTGAATTTGGGGG - Intronic
1139395211 16:66633345-66633367 AACCATCAGGCTGGCTCTGCTGG + Intronic
1142707525 17:1705827-1705849 GAACAGCAGACTTAATCTGCTGG + Exonic
1143250925 17:5522450-5522472 CACCAACACACCAAATCTGCTGG + Intronic
1145879891 17:28345257-28345279 CTCCCTCAGATTGATTCTGCAGG - Exonic
1145959144 17:28876301-28876323 CACCATCTGGCTGCATGTGCAGG - Intergenic
1146580078 17:34029742-34029764 CACCAGAAAATTGAATCTGCTGG + Intronic
1149775877 17:59356749-59356771 CCTCACCAGACTGAATCTGGTGG - Intronic
1151426999 17:74037467-74037489 GACCAGAAGACTGAATCTCCTGG + Intergenic
1158339451 18:56449748-56449770 CAGCATCAGACTTATTCTGGTGG + Intergenic
1158588171 18:58758628-58758650 CAGCATCAGGCAGACTCTGCAGG + Intergenic
1158999238 18:62956252-62956274 CCTCATCAGACCAAATCTGCTGG - Intronic
1161293906 19:3509981-3510003 CACCATCAGACACGATCAGCCGG - Intronic
1162387480 19:10368531-10368553 CAACGTGAGACTGAAGCTGCAGG - Intronic
1164916288 19:32054822-32054844 CACCAGAAAACTGAACCTGCTGG - Intergenic
925693984 2:6554695-6554717 CACCCTCTCACTGTATCTGCTGG + Intergenic
926585337 2:14679882-14679904 CACCAACATAGTGTATCTGCAGG + Intergenic
929985305 2:46725786-46725808 CTCCTTCAGAGTGGATCTGCTGG + Intronic
930461119 2:51677671-51677693 CACAATAGGACTGAATCTGTAGG - Intergenic
933250405 2:80022984-80023006 AACCATCAGATTCCATCTGCTGG + Intronic
935467054 2:103411145-103411167 AACCTTCAGACTGACTCTCCAGG + Intergenic
937282793 2:120731809-120731831 CACCAGACCACTGAATCTGCTGG + Intergenic
938600007 2:132828122-132828144 CCTCGCCAGACTGAATCTGCTGG + Intronic
939826846 2:147025365-147025387 CAGCCTCAGAATGAGTCTGCAGG + Intergenic
942471614 2:176266753-176266775 CCCCAAGACACTGAATCTGCTGG + Intergenic
943757411 2:191570956-191570978 CACCATCAGAATCAAACGGCAGG - Intergenic
945878764 2:215305327-215305349 CCTCATCAGACTTAACCTGCTGG + Intergenic
946013620 2:216586564-216586586 CCCCCTGAGACTTAATCTGCAGG - Intergenic
948994976 2:241573425-241573447 CACCTTCAGATTGAATGTGCAGG - Exonic
1172976298 20:38908358-38908380 CACCATCAGACTGAATCTGCTGG - Intronic
1175608866 20:60333541-60333563 CACCATCACACTGAAGATGAAGG + Intergenic
1179390902 21:40990375-40990397 GACCTTCAGCCTGAGTCTGCAGG + Intergenic
1179449848 21:41461027-41461049 CCCCAGCAGAGTGAACCTGCTGG + Intergenic
1184508313 22:44917389-44917411 CACCATCAGAAACACTCTGCTGG - Intronic
1185307861 22:50131953-50131975 CACCAGGACACTGAACCTGCTGG - Intronic
949090168 3:17948-17970 CAAGAACAGACTGAAACTGCAGG - Intergenic
953995410 3:47515516-47515538 CAACATCAGACTGATTGTGACGG + Intergenic
956708183 3:72017544-72017566 TACCATCAGAATGAATGTTCTGG + Intergenic
958487509 3:94731205-94731227 CCCCATCATACTGAAGCAGCTGG - Intergenic
961081355 3:124031945-124031967 ACCCATCAGACAGAATCTCCTGG - Intergenic
961194950 3:124993729-124993751 CAACATTAGACTTCATCTGCTGG + Intronic
961410342 3:126715917-126715939 GACCATCTGACTGAATGCGCAGG - Intronic
963807869 3:149744434-149744456 CACCATCAGACTGATGCAGGAGG - Intronic
965464922 3:169017329-169017351 CCTCACCAGACTGAATCTGCAGG - Intergenic
966044158 3:175529638-175529660 CACCATCATCCTGAAGCAGCTGG - Intronic
967457204 3:189702240-189702262 AAACATCAGACAGAAACTGCAGG + Intronic
969842150 4:9890609-9890631 CACCATCACGCTGACCCTGCAGG - Exonic
972010200 4:34169576-34169598 TTCCATCAGACTGCATCTGTTGG - Intergenic
976016685 4:80563161-80563183 AAAAATCAGACTTAATCTGCAGG + Intronic
978293587 4:107175969-107175991 GACCACCAGACAGAATCGGCAGG + Intronic
986220495 5:5764841-5764863 CCTCATCAGACTGAACCTGGCGG - Intergenic
987816320 5:22905600-22905622 CACCATACAACAGAATCTGCTGG - Intergenic
989707866 5:44359496-44359518 CTCCCTCAGATTCAATCTGCAGG - Intronic
991233673 5:64367183-64367205 CACCACCAGACTGGCTCTGTAGG + Intronic
992381872 5:76245454-76245476 CACGATCAGACTTAATAAGCAGG + Intronic
992849424 5:80790862-80790884 CACCATCACCATGAATATGCAGG - Intronic
994291193 5:98030685-98030707 CCCCATCATACTGAAGCAGCTGG - Intergenic
995269390 5:110204215-110204237 CCCCATCATCCTGAAGCTGCTGG - Intergenic
996283291 5:121758626-121758648 GACCATGTGACTAAATCTGCCGG - Intergenic
1000422710 5:161056608-161056630 CCCCATCATCCTGAATCAGCTGG - Intergenic
1002375138 5:178783305-178783327 CAGCAGCAGGGTGAATCTGCAGG + Intergenic
1004440323 6:15643751-15643773 CACCATCAGACTGGACCTACAGG + Intronic
1006727761 6:36212056-36212078 CCCCATCTGGCTGAATCTACAGG + Intronic
1009905038 6:69859807-69859829 CACCATCAGACTGACATTGATGG + Intergenic
1010406837 6:75515600-75515622 CACCACCATCCTGAAGCTGCTGG - Intergenic
1016019437 6:139220212-139220234 CTCCCACACACTGAATCTGCTGG + Intergenic
1017539357 6:155384578-155384600 AACAATCATTCTGAATCTGCGGG + Intergenic
1024112552 7:46161941-46161963 CACCATGTAACCGAATCTGCAGG + Intergenic
1036013303 8:4752656-4752678 CACCATCAGATTTTATCTGCTGG - Intronic
1039752613 8:40492230-40492252 CTCCAGGAGACTGAATCTGCAGG + Intergenic
1043821707 8:84874236-84874258 CAACATAAGACTTAATTTGCTGG + Intronic
1046495186 8:115004810-115004832 CTTCATCAGACAGGATCTGCTGG + Intergenic
1047995028 8:130326483-130326505 CACGAACAGACTGGATGTGCTGG + Intronic
1048429021 8:134351246-134351268 CACGATCAGAGTGAAACTGAAGG - Intergenic
1048571666 8:135662088-135662110 CACCAAGACACAGAATCTGCCGG - Intergenic
1049978157 9:879728-879750 CAAGATCAGACTAGATCTGCTGG + Intronic
1058251301 9:102698608-102698630 CTTCACCAGACAGAATCTGCTGG + Intergenic
1059598126 9:115745044-115745066 CAACATCAGCCTGAGTCTCCAGG + Intergenic
1061897243 9:133654907-133654929 CACCATCAGCCCCATTCTGCAGG + Intronic
1187670893 X:21664960-21664982 CACCATCCACCTGAAACTGCCGG - Intergenic
1189430023 X:40938059-40938081 GACCATCAGAATGACCCTGCTGG + Intergenic
1190073937 X:47301757-47301779 CACCATCAGGCTGAATGCGGTGG - Intergenic
1194443703 X:93962357-93962379 CCCCATCAGCCTGAAGCAGCTGG + Intergenic
1194513258 X:94820996-94821018 CCCCATCATACTGAAGCAGCTGG - Intergenic
1195748737 X:108143979-108144001 CCCCATCAGCCTGAAGCAGCTGG - Intronic
1200737040 Y:6811180-6811202 CATCATAAGACAGAATCTGTTGG - Intergenic