ID: 1172976304

View in Genome Browser
Species Human (GRCh38)
Location 20:38908388-38908410
Sequence CTGTAGTTAAGGAGGTGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172976298_1172976304 7 Left 1172976298 20:38908358-38908380 CCAGCAGATTCAGTCTGATGGTG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG 0: 1
1: 0
2: 2
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172976304 Original CRISPR CTGTAGTTAAGGAGGTGATC GGG Intronic
900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG + Intronic
902490755 1:16779044-16779066 CTGGAGTTGAGGGGGTGATGTGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
908806205 1:67936067-67936089 CTGTAGTTTAGGAGGTAAAGAGG + Intergenic
910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG + Intergenic
912118505 1:106438286-106438308 CTATAGTGAAAGAGATGATCTGG - Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
915955846 1:160219285-160219307 CTGGAGTGAATGAGGTCATCTGG - Intronic
918689355 1:187461185-187461207 CAGTAGTTTAGGAGATGATATGG - Intergenic
920697720 1:208194264-208194286 CTGCTGTTAATGAGCTGATCTGG + Intronic
920819272 1:209365166-209365188 CTGTAGTCAAAGTGGTTATCAGG - Intergenic
922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG + Intronic
923529689 1:234803491-234803513 CTGGAGTTGAGGGGGTGATGTGG - Intergenic
1069217290 10:65838162-65838184 CTGTAGTTAAACATGTTATCAGG - Intergenic
1074358614 10:112807340-112807362 CTGAAGTTAAGGAGTTGACAGGG + Intronic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1077701555 11:4446745-4446767 CTGTAGTGGATGAGGTGAGCAGG + Intergenic
1078038252 11:7831791-7831813 CTGAAGTTAAGGAAGGGATGGGG - Intergenic
1078187179 11:9061986-9062008 GTGGAGTTAAGGAGGAGCTCTGG - Intronic
1082888285 11:58111276-58111298 CTGAATTTAAGGAGATGCTCAGG + Intronic
1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG + Intronic
1084236575 11:67791506-67791528 CTGCAGTTTCGGAAGTGATCAGG + Intergenic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1091480500 12:824638-824660 CTGTAATTAGGGAGGTGCTATGG + Intronic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1094165455 12:27438367-27438389 CTGGAGCTAAGGAGAAGATCAGG - Intergenic
1095716815 12:45355414-45355436 CTGTATTTAAAGAGCTGGTCAGG - Intronic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1101569137 12:105937039-105937061 CTGTTGTGGAGGAGGGGATCAGG - Intergenic
1102596478 12:113996633-113996655 CATCAGTTAATGAGGTGATCAGG + Intergenic
1108866517 13:54930431-54930453 ATGTAGTTAAGGTAGGGATCAGG + Intergenic
1109741365 13:66560130-66560152 CTGTTGGTAAGGAAGTGTTCGGG - Intronic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1112714059 13:102163634-102163656 CAGTATTCGAGGAGGTGATCTGG + Intronic
1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG + Intergenic
1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG + Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1124466043 15:29940896-29940918 CTGTGGTTATGGTGGTCATCGGG - Intronic
1126938949 15:53744562-53744584 CTATGGTTTAGGAGGTGATTGGG - Intronic
1128711314 15:69874399-69874421 CTGTGATGAAGGGGGTGATCAGG - Intergenic
1130848028 15:87765719-87765741 CTGTAGTTAAGGTGATGACCAGG - Intergenic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1133348168 16:5084028-5084050 CTGCGGTTGAGGAAGTGATCAGG + Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1137874904 16:51986757-51986779 GAGAAGTTAAGGAGATGATCAGG - Intergenic
1138608274 16:58102870-58102892 CTGTAGTTAAGCATGTCATGGGG + Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1141360000 16:83386868-83386890 CTGTATTTAAGGAAGAGATAAGG + Intronic
1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG + Intronic
1154938171 18:21082580-21082602 CTGTATCTAATGAGGTGATGTGG - Intronic
1162339458 19:10083443-10083465 TTGCAGTTAAGGAGTTGGTCAGG - Intergenic
1166828869 19:45626505-45626527 CTGGAGTTAAGAGGGTGACCGGG - Intronic
925989884 2:9246104-9246126 CTGAAGTCAAGCAGCTGATCAGG - Intronic
928364532 2:30691124-30691146 CTGGACTAAAGGAGGTGTTCAGG - Intergenic
929637662 2:43541708-43541730 CTTTAGTCCAGGAGGTGATGTGG - Intronic
934163347 2:89272707-89272729 CTAGGGTTAAAGAGGTGATCAGG - Intergenic
934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG + Intergenic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
945233522 2:207613328-207613350 CTGTTGTTAAGGAGCTGACTTGG - Exonic
1171935821 20:31274208-31274230 CTGCAGTGAAGGAGGTCACCAGG - Intergenic
1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG + Exonic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173179734 20:40796773-40796795 CTGTAGGAAAGAAGGGGATCTGG - Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1178740354 21:35194285-35194307 CTGTAGGTAAGATGGTGATATGG - Intronic
950252267 3:11475605-11475627 CTGCAGATCAGCAGGTGATCAGG + Intronic
950321419 3:12058130-12058152 CTGTAGATAAGTAGGCCATCTGG + Intronic
951690227 3:25387367-25387389 CTGTAGGAAAGAGGGTGATCTGG - Intronic
953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG + Exonic
953728957 3:45428625-45428647 ATGTAGGTAAGGAGTTCATCTGG - Intronic
954952744 3:54489611-54489633 CTGTAGATAAGGAGCAGAGCTGG + Intronic
955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG + Intronic
955894808 3:63687803-63687825 CTTTAGTTAAGCAGCTGCTCTGG + Intergenic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
968082020 3:195853100-195853122 CTGAAGAGAAGGAGGTGCTCAGG + Intergenic
968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG + Intergenic
969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG + Intronic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG + Intronic
979528396 4:121741360-121741382 CTGTAGTCAAATAGGTGGTCAGG - Intergenic
981342020 4:143632557-143632579 CAGTACTTAAGAAGGTGGTCTGG + Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
989206899 5:38818648-38818670 CTGTATTTTAGGAGGAGATTTGG - Intergenic
991646345 5:68804149-68804171 CTGTCGAAAAGGAGGTGAACTGG - Intergenic
991977155 5:72194738-72194760 CTGAAGTTAAGTAGGAAATCGGG - Exonic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
992868985 5:80987066-80987088 CTGTAGAAAAGGAGCTCATCTGG - Intronic
993038039 5:82779163-82779185 CTGTAGTTAAGGAAAGGGTCTGG - Intergenic
1003035856 6:2639728-2639750 CTCTAAATGAGGAGGTGATCTGG - Intergenic
1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG + Intergenic
1005451169 6:25974143-25974165 CTGCAGTTAAGGTGTTGGTCAGG + Intronic
1006262011 6:32882608-32882630 CAGTGGTTAAGGAAGTGATGGGG + Intergenic
1009736316 6:67680511-67680533 TTGTAGTTAAGGAGTGGAGCTGG - Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1010777313 6:79902185-79902207 CTGTAGTGAAGGCGGTAACCAGG + Intergenic
1010852720 6:80797520-80797542 CTGTTGTTGGGGAGGTGAGCAGG + Intergenic
1011494962 6:87928492-87928514 CTGTATTTAAGGATCTGAACAGG - Intergenic
1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG + Intergenic
1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG + Intergenic
1015404415 6:132821059-132821081 GCGTGGTTAAGGAGGTGACCTGG + Intergenic
1015803326 6:137082816-137082838 CTGTAGGTAAGCAGATGGTCAGG - Intergenic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1016769745 6:147835806-147835828 CTGGAGACAAGGAGGTGATGCGG - Intergenic
1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG + Intergenic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1022704455 7:32789550-32789572 CAGGAGTTAAGGAGGAGATCGGG + Intergenic
1023485618 7:40683207-40683229 TTCTAGTTAAGAAAGTGATCAGG + Intronic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1029906767 7:104100645-104100667 CTCTAGTGAAGGAGATGACCAGG - Intergenic
1031875515 7:127135496-127135518 CTGTAGTTAAGGATGGGAATAGG + Intronic
1033109924 7:138564682-138564704 ATGTATTTAAGGTGGTGATTGGG - Intronic
1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG + Intronic
1042966096 8:74354149-74354171 CTATAGTTGAAGAGGTAATCTGG - Intronic
1044479876 8:92672883-92672905 CTTTAGATAAGCAGGTGATATGG - Intergenic
1045019805 8:98032150-98032172 AGGTAGGTAAGGAGGTGGTCTGG + Intronic
1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG + Intergenic
1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG + Intergenic
1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG + Intronic
1053751199 9:41257775-41257797 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054256721 9:62822104-62822126 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054334586 9:63793508-63793530 ATGTATTTAATGAAGTGATCCGG + Intergenic
1055798284 9:80000625-80000647 CTGAATTTAAGAAGGAGATCTGG - Intergenic
1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG + Exonic
1058179386 9:101778670-101778692 CTGCAGTTAAGGAATTAATCCGG - Intergenic
1059771074 9:117426421-117426443 CTGTAGTCAAGGCTGTGATGAGG + Intergenic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG + Intergenic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG + Intronic
1203707868 Un_KI270742v1:69018-69040 GTGTTGTCACGGAGGTGATCAGG - Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1189804880 X:44725338-44725360 CAGGAGTTAAGGAGTTAATCAGG - Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1196062934 X:111430799-111430821 CTGTGGTTAATTAGGAGATCAGG - Intergenic
1198459249 X:136847451-136847473 CTGTAGCTAAGGAGGTCTTCCGG - Intergenic
1198613904 X:138432587-138432609 CTTTAGTGAAGAAGGTGATGAGG + Intergenic
1198941881 X:141965189-141965211 CTGTAATTCAGGAGGAGATTTGG + Intergenic
1201927185 Y:19300045-19300067 CTGGAGTTAAGGATGTGCCCAGG + Intergenic