ID: 1172977553

View in Genome Browser
Species Human (GRCh38)
Location 20:38918329-38918351
Sequence GGCCACGCCAGGGTTGCCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172977553_1172977561 8 Left 1172977553 20:38918329-38918351 CCTATGGCAACCCTGGCGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1172977561 20:38918360-38918382 CCCGCCCTGGAGCAGCTACAAGG 0: 1
1: 0
2: 1
3: 9
4: 168
1172977553_1172977556 -5 Left 1172977553 20:38918329-38918351 CCTATGGCAACCCTGGCGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1172977556 20:38918347-38918369 TGGCCGACGCCACCCCGCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172977553 Original CRISPR GGCCACGCCAGGGTTGCCAT AGG (reversed) Exonic
903185617 1:21627206-21627228 AGCCACGTCAGGGTGGCCCTAGG - Intronic
903664493 1:24997991-24998013 GGCCATGCCAGGGCTGCCGTAGG - Intergenic
908762251 1:67522984-67523006 GGCCACTCCAGCGTGGCCAGAGG + Intergenic
923541147 1:234889046-234889068 GGCCAGCCCCTGGTTGCCATGGG - Intergenic
1067317387 10:45181011-45181033 GGCCACGCCATTGGTGGCATGGG + Intergenic
1069825663 10:71253677-71253699 GGCATCGCCAGGGCTGCCAAGGG + Intronic
1074354480 10:112769937-112769959 ATCCACCCCATGGTTGCCATAGG + Intronic
1075153890 10:119958329-119958351 GGCCACGCATGCATTGCCATGGG + Intergenic
1075553052 10:123408027-123408049 GGCCACAGCAAGGTGGCCATGGG - Intergenic
1076724868 10:132408577-132408599 GGCCAGGCCAGGGTGGCCGGTGG - Intronic
1083308518 11:61772845-61772867 GGCCTGGCCAGTGTTGCCAAAGG - Intronic
1085472633 11:76767997-76768019 GGCCTGGCCAGGGTGGCCGTGGG - Intergenic
1092139338 12:6171981-6172003 GGCCAGGCCAGCATTGCCCTGGG + Intergenic
1092281711 12:7102370-7102392 GGGAACACCAGGGTTCCCATGGG + Intronic
1093980142 12:25467077-25467099 GGCCACACAGGGGTTGCAATCGG - Intronic
1096242622 12:49967432-49967454 GGCCACGGCAGGGTGGACAGTGG + Intronic
1096565255 12:52473004-52473026 GGCCACTCCAGAGATCCCATGGG + Intronic
1096567275 12:52492455-52492477 GGCCACTCCAGAGATCCCATGGG + Intronic
1097236859 12:57546529-57546551 GTACACGCCAGGATTGTCATGGG + Intronic
1102352478 12:112204312-112204334 GGCCCCACCAGGGTTGCCCTAGG + Intronic
1102968139 12:117144516-117144538 GGTCACCCCAGGGTTTCCAAAGG + Intronic
1113916990 13:113880170-113880192 ATCCAAGCCTGGGTTGCCATTGG - Intergenic
1118347138 14:64948556-64948578 GGCCGCTGCAGGGTTGCCAGGGG - Intronic
1122923103 14:104888007-104888029 GGCCAAGACAGGGCTGCCAGTGG + Intronic
1123019210 14:105389770-105389792 GGCCAGGCCAGGGCTGGCAGTGG + Intronic
1123119117 14:105908859-105908881 GGCCAGGTCAGGGTGGCCCTGGG + Intergenic
1123404062 15:20010080-20010102 GGCCAGGTCAGGGTAGCCCTGGG + Intergenic
1123513401 15:21016726-21016748 GGCCAGGTCAGGGTAGCCCTGGG + Intergenic
1129335824 15:74851565-74851587 GGCCAAACCAGGGTTCCCAGAGG + Intronic
1131068452 15:89449030-89449052 GGCCAGGCCGGGGATGCCTTTGG - Intergenic
1131730054 15:95270011-95270033 GGCAATGTCACGGTTGCCATTGG - Intergenic
1132976169 16:2712172-2712194 GGCCGCCCCAGGGTTGGCACTGG - Intergenic
1138594908 16:58024821-58024843 CGCCGCGCCAGGGCTGCCCTTGG + Intergenic
1139493296 16:67298901-67298923 GGCCAGGCCAGGCTTCCCAGAGG - Intronic
1140990151 16:80202903-80202925 GGCCAAGCCAGAGTTCTCATGGG - Intergenic
1141442903 16:84040921-84040943 GCCAACGCCAGGGGTGTCATGGG + Intronic
1143113476 17:4567096-4567118 GCCCAAGCCAGGGCTGCCCTTGG - Intergenic
1143249768 17:5514579-5514601 GTCCATGCCAGGGATGCCACAGG - Intronic
1144312326 17:14024690-14024712 GGCCACACCAGAGATCCCATTGG + Intergenic
1144332428 17:14236635-14236657 GGCCACACCAGAGATCCCATTGG - Exonic
1144428529 17:15169150-15169172 GGCAAGGCCAGGGGTGCTATGGG - Intergenic
1145161782 17:20579920-20579942 GGCCACACCAGAGATCCCATCGG + Exonic
1152738444 17:82008711-82008733 GGCCACGTCAGGGTCTCCATGGG - Intronic
1161306604 19:3572552-3572574 GGCCCCGCCCCGGTTGCCATGGG - Intronic
1161460052 19:4391199-4391221 GGCCACCCCTGGGTGGCCAGGGG + Intronic
1162879446 19:13647317-13647339 GGCCATCACAGGGTTGCCTTTGG - Intergenic
1163811971 19:19438725-19438747 GGCCACCCCAGGTTTTCCTTTGG + Intronic
1165837751 19:38770036-38770058 AGCCACGCCAGGGCTGTGATCGG - Intergenic
1165841816 19:38792663-38792685 AGCCAGGCCAGGGCTGCGATCGG + Intergenic
1167145646 19:47679823-47679845 GGCACCCCCAGGGCTGCCATTGG - Exonic
1167593373 19:50415950-50415972 GGCCACACCCAGGCTGCCATGGG - Intronic
927640792 2:24844201-24844223 GGCCAGGCCCGTGTCGCCATGGG + Intronic
931877157 2:66526385-66526407 GGCCAGGCCCGGCCTGCCATGGG - Intronic
932405085 2:71507287-71507309 GGCCACACCTGGGCTGCCCTTGG - Intronic
933828223 2:86183640-86183662 AGCCACCCCATGCTTGCCATAGG + Intronic
940908351 2:159188729-159188751 GGCTTGGCCAGGGTGGCCATAGG - Intronic
948918858 2:241052173-241052195 GGCCAGGCCAGGGCGGCCAGGGG + Intronic
1169149232 20:3276280-3276302 GGCCTGACCAGGCTTGCCATGGG - Intronic
1171192047 20:23165656-23165678 GGCAATGCCAGGAGTGCCATGGG + Intergenic
1172481106 20:35271845-35271867 GGCCGGGCCAGGGTGGGCATGGG + Intronic
1172661482 20:36572171-36572193 AGCCACGTCTGGGTTGCCTTAGG - Intergenic
1172977553 20:38918329-38918351 GGCCACGCCAGGGTTGCCATAGG - Exonic
1173251392 20:41365974-41365996 GGCCACGCTGGGGCTCCCATGGG + Intronic
1174444614 20:50582256-50582278 GGTCACCACAGGGTGGCCATTGG + Intronic
1179790754 21:43754671-43754693 GGGCAGGGCAGGGGTGCCATGGG + Intronic
1183695572 22:39420016-39420038 GGCGAAGCCAGAGTTGGCATGGG + Intronic
1184464388 22:44660370-44660392 GGCCACTCCAGGACTGCGATGGG - Intergenic
953033197 3:39191129-39191151 GGACATGCCAGGGTGGGCATGGG - Intronic
953761372 3:45689651-45689673 GGCCTCGCCCGAGTAGCCATAGG + Intronic
961142771 3:124569217-124569239 GAACAAGCCAGGGGTGCCATGGG - Intronic
966646232 3:182248685-182248707 GGCCACCCCAGGGTTTCCTGAGG - Intergenic
967241691 3:187445762-187445784 AGCCACTCCAGGCTTGCCAATGG + Intergenic
971158053 4:24104225-24104247 GGCCAGGCCCGGGTGGCTATAGG + Intergenic
976878572 4:89889616-89889638 GGCCACACCAGGGCTGCACTCGG - Intronic
985068536 4:186145369-186145391 GGGCACTCCAGGGTGGCCATGGG - Intronic
985631258 5:1015257-1015279 GGCCACGCCAGGGAGGCTGTGGG - Intronic
986458436 5:7944007-7944029 GGCCGAGCCAGTGTGGCCATGGG + Intergenic
1003036561 6:2645118-2645140 AGCCATGCCTAGGTTGCCATTGG + Intergenic
1005825360 6:29628644-29628666 GGCCTGGCCAGGGTTGGGATGGG + Intronic
1009466550 6:63977644-63977666 GGCCACTCCATGGTTGCCTGAGG - Intronic
1010414813 6:75601616-75601638 GCACACGCCAGGTCTGCCATGGG + Intronic
1013624108 6:111920082-111920104 AGCCAGGCCAGGGTGCCCATCGG - Intergenic
1015984945 6:138875424-138875446 GGACATCCAAGGGTTGCCATTGG + Intronic
1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG + Exonic
1019587816 7:1814481-1814503 GGCCACCCCAGGGCTGCGATGGG + Intergenic
1020098694 7:5382473-5382495 GGCCAGGAAGGGGTTGCCATGGG - Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021214501 7:17900294-17900316 GGCCAGGCCATGGTTACCACAGG - Intronic
1025823906 7:64995659-64995681 GGCCAAGCCAGCGTTCCCCTTGG + Intronic
1030708933 7:112726346-112726368 GGCCACTCGGGGGTTGCAATGGG - Intergenic
1031290835 7:119931383-119931405 GGCCACTGCAGAGTTGCCATGGG + Intergenic
1034686783 7:152978879-152978901 GGTCACACCATGGTTGTCATTGG - Intergenic
1035889708 8:3330046-3330068 GGCCACACCATGACTGCCATGGG - Intronic
1038747425 8:30266822-30266844 GGCCACTCCAGTGTTTCCAGAGG + Intergenic
1048517520 8:135124315-135124337 GACCAGTCCAGGGCTGCCATGGG + Intergenic
1056124835 9:83525735-83525757 AGCCACACCAGGGTTGTCAGTGG - Intronic
1057918062 9:99072664-99072686 GGCCACGTCCAGGTTGCCAGGGG - Intergenic
1059349392 9:113653894-113653916 GGCCAGGGCAGGGGTGCCAGGGG - Intergenic
1060513201 9:124249078-124249100 GGACACGCCAGGCTTGTCTTGGG - Intergenic
1062316516 9:135969893-135969915 GGCCACAGCAGTTTTGCCATAGG + Intergenic
1062508975 9:136894476-136894498 GCCCACCTCAGGGTTGCCAAGGG + Intronic
1185641730 X:1592303-1592325 GGCCCTGCCAGGGGTGCCAGCGG + Intronic
1198854527 X:141002516-141002538 AGCCACCCTAGGGCTGCCATTGG + Intergenic
1198877490 X:141242613-141242635 AGCCACCCTAGGGCTGCCATTGG - Intergenic
1198908173 X:141584834-141584856 AGCCACCCTAGGGCTGCCATTGG - Exonic
1198908618 X:141589590-141589612 AGCCACCCTAGGGCTGCCATTGG + Exonic
1198918452 X:141698561-141698583 AGCCACCCTAGGGCTGCCATTGG - Exonic