ID: 1172978498

View in Genome Browser
Species Human (GRCh38)
Location 20:38923955-38923977
Sequence TGTCCCACACAGAACTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172978495_1172978498 -6 Left 1172978495 20:38923938-38923960 CCACAGTCCTTGGTCCTTGTCCC No data
Right 1172978498 20:38923955-38923977 TGTCCCACACAGAACTTTGTTGG No data
1172978494_1172978498 1 Left 1172978494 20:38923931-38923953 CCTCAGACCACAGTCCTTGGTCC No data
Right 1172978498 20:38923955-38923977 TGTCCCACACAGAACTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172978498 Original CRISPR TGTCCCACACAGAACTTTGT TGG Intergenic
No off target data available for this crispr