ID: 1172979278

View in Genome Browser
Species Human (GRCh38)
Location 20:38928660-38928682
Sequence CACTGGAACTAGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172979272_1172979278 2 Left 1172979272 20:38928635-38928657 CCAAATTTTAGTGATAGCAAAAG 0: 1
1: 0
2: 2
3: 27
4: 304
Right 1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 189
1172979268_1172979278 9 Left 1172979268 20:38928628-38928650 CCCAGCCCCAAATTTTAGTGATA 0: 1
1: 0
2: 2
3: 11
4: 195
Right 1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 189
1172979270_1172979278 4 Left 1172979270 20:38928633-38928655 CCCCAAATTTTAGTGATAGCAAA 0: 1
1: 0
2: 2
3: 23
4: 327
Right 1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 189
1172979271_1172979278 3 Left 1172979271 20:38928634-38928656 CCCAAATTTTAGTGATAGCAAAA 0: 1
1: 0
2: 0
3: 37
4: 397
Right 1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 189
1172979269_1172979278 8 Left 1172979269 20:38928629-38928651 CCAGCCCCAAATTTTAGTGATAG 0: 1
1: 0
2: 2
3: 11
4: 131
Right 1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172979278 Original CRISPR CACTGGAACTAGAGGCCAGA GGG Intronic
901090865 1:6640211-6640233 CTTTGGAACGGGAGGCCAGAAGG - Intronic
901249886 1:7770141-7770163 CTCTGGCAGTAGTGGCCAGATGG - Intergenic
901736017 1:11312675-11312697 CACTGGAATAAAAGGGCAGATGG + Intergenic
901761750 1:11476567-11476589 CACTGGAACAAGGAGCCAGAGGG + Intergenic
901826157 1:11862962-11862984 GACTGGAGATTGAGGCCAGAGGG - Intergenic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902860529 1:19242038-19242060 AACTTGAACTAGAAGTCAGAAGG + Intronic
903844346 1:26268932-26268954 TACTGAAACTAGAAGCAAGAGGG - Intronic
904377889 1:30093282-30093304 TACTGAAACTAGAAGCAAGAGGG + Intergenic
904569726 1:31453964-31453986 TACTGAAACTAGAGGCAAGGGGG + Intergenic
904571838 1:31471806-31471828 TACTGAAACTAGAGGCAAGCGGG + Intergenic
904750832 1:32740885-32740907 CAACGGAAATGGAGGCCAGAAGG - Intergenic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
907390849 1:54157271-54157293 CACTGGAATGAAAGCCCAGAAGG - Intronic
907762810 1:57378063-57378085 CAAATGAACCAGAGGCCAGAGGG + Intronic
907843595 1:58182112-58182134 TACTAGAAATAGAGGCCGGAAGG - Intronic
908728632 1:67203389-67203411 GTCTGGAAGTAGAGGCCAGATGG - Intronic
910468166 1:87522873-87522895 CACTGGGACTAGAGACCCCATGG + Intergenic
918209616 1:182339414-182339436 CTATGGTACTAGGGGCCAGAAGG - Intergenic
919284760 1:195542123-195542145 CTCTGGAAGCTGAGGCCAGACGG + Intergenic
919805509 1:201379010-201379032 CACTGGACTCAGAGGCCACAGGG - Intronic
919962262 1:202483588-202483610 TACTGAAGCTAGAGGCAAGAGGG + Intronic
922007836 1:221550462-221550484 CACAGAAGCTAAAGGCCAGAAGG + Intergenic
923503035 1:234582217-234582239 CACTGGGCTCAGAGGCCAGATGG - Intergenic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
1069653203 10:70066513-70066535 AACTGGAGCTGGAGGTCAGAGGG + Intronic
1069754111 10:70762730-70762752 AAATGCAACTAGAGGCCAGTGGG + Intergenic
1073623579 10:105073691-105073713 CACTGGATGTAGAGGTCAGAGGG + Intronic
1074118730 10:110477428-110477450 AAATAGAACTGGAGGCCAGAGGG - Intergenic
1074661598 10:115665044-115665066 CACTGAAACTGAAGACCAGATGG + Intronic
1075414157 10:122250085-122250107 CCCTGGAATTAGAGGCCACCTGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1077559649 11:3251353-3251375 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077565542 11:3297156-3297178 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077773907 11:5250211-5250233 CACTGGAGCTAGAGACAAGAAGG - Intronic
1077774409 11:5255139-5255161 CACTGGAGCTACAGACAAGAAGG - Exonic
1078021112 11:7656638-7656660 CACCGGAACTAGAGGGCACTGGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079010754 11:16826307-16826329 CACTGGCCCAAGAGGCCAGCAGG - Exonic
1083896647 11:65623440-65623462 CACTGGAAGGTGAGGCAAGACGG + Intronic
1083940371 11:65892186-65892208 CACTGGACCCAGAGGCCAATGGG - Intronic
1090442375 11:126735094-126735116 CACTGGAACTCGGGGCTAGGAGG + Intronic
1091626383 12:2124078-2124100 CAGTGGAAGGAGAGACCAGAGGG - Intronic
1094751660 12:33416586-33416608 CATTGAACCTAGAGGCCAAAGGG - Intronic
1095199532 12:39366382-39366404 TACTGGAGCTACAGGCGAGAGGG - Exonic
1096885839 12:54718231-54718253 CACTGGAAGTGGAGGCAATATGG + Intergenic
1097844958 12:64356724-64356746 TACTGAAACTAGAGGCAAGGGGG + Intronic
1097976875 12:65695861-65695883 CACTGGACTTTGAGGCCAGTGGG + Intergenic
1098231557 12:68376355-68376377 CGCTGGGAGGAGAGGCCAGAGGG - Intergenic
1098553846 12:71795732-71795754 CACTGGAACTAGAGAACTGGAGG + Exonic
1099952060 12:89314687-89314709 CCCTGGAACACAAGGCCAGATGG + Intergenic
1100158149 12:91826060-91826082 CAGTGGAACTAGAGAACAAAAGG - Intergenic
1101197754 12:102402886-102402908 GAAAGGATCTAGAGGCCAGAAGG - Intronic
1104510384 12:129372454-129372476 CAGTGGCATTAGAGGCCACATGG + Intronic
1104584457 12:130036902-130036924 CACTGGACCTTGAGGCCCCATGG - Intergenic
1104884232 12:132095848-132095870 TACTGAAACTAGAGGCAAGGGGG - Intronic
1106222066 13:27754629-27754651 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112337020 13:98524288-98524310 CACAGGAACCACAGGCCAGGTGG - Intronic
1114223228 14:20715552-20715574 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1114224636 14:20726227-20726249 TACTGAAACTAGAGGCAAGGAGG + Intergenic
1115780756 14:36765474-36765496 GACTGGAAACAGAGGCCTGAAGG + Intronic
1115828612 14:37309004-37309026 CACTGGAAGCAGTGGCCTGAGGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1119437155 14:74605075-74605097 CACTGGAACTAGAGGGTAAGAGG + Intronic
1119599448 14:75965311-75965333 CACTAGGACCAGAGGCTAGATGG + Intronic
1121308265 14:92920981-92921003 CACTGGAACTAGTGAACAGAAGG - Intergenic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1125332758 15:38598215-38598237 CCTGGGCACTAGAGGCCAGAGGG - Intergenic
1125609367 15:40960368-40960390 CACTGGAGATAGAGGCAAGCAGG + Intergenic
1126898440 15:53285986-53286008 CAGAGGAAGTAGAGACCAGAAGG + Intergenic
1128321640 15:66698805-66698827 CACTGAAACCAGAGTCCAGTGGG - Intergenic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1129313966 15:74729931-74729953 CACTAGAACTAGAGGCAGGCAGG - Intergenic
1129634357 15:77298977-77298999 CACAGGGATTAGAGGGCAGAGGG - Intronic
1130987061 15:88851585-88851607 CACTGGAACTAAAGTGCTGATGG + Intronic
1131823685 15:96298233-96298255 CACTGGGACTAGGGTACAGAAGG + Intergenic
1132076842 15:98828598-98828620 CACTGGAACTGAAGGTCAGTGGG - Intronic
1134256202 16:12613731-12613753 CACTGAATCTAGAGGCAAGGGGG - Intergenic
1135379705 16:21985220-21985242 CTTTGGAAGCAGAGGCCAGAGGG - Intronic
1135625648 16:23992669-23992691 CCCTGCAACTACAGGCTAGAAGG - Intronic
1137805768 16:51304023-51304045 CACTGAAATAAGAGCCCAGAGGG - Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1143331849 17:6143161-6143183 CAATGGAAGGAGAGGTCAGAAGG - Intergenic
1143793742 17:9319576-9319598 GACTGGAACAAGAAGCCAGAGGG + Intronic
1146097356 17:29944345-29944367 CACTGAGATTATAGGCCAGAGGG + Intronic
1146516235 17:33491737-33491759 GCCTGAAACTAGAGGCTAGAGGG + Intronic
1148539914 17:48472179-48472201 CAGAGGAGCTAGAGGCCAGTGGG + Intergenic
1150323996 17:64241098-64241120 CACTGCATCTGGAGGCCAGCTGG - Intronic
1151001447 17:70381528-70381550 CACTGCTAATAGAGGCCAGGTGG - Intergenic
1152218391 17:79047614-79047636 CACTGGACCCAAAGGGCAGAAGG + Exonic
1152319842 17:79602550-79602572 AAGTGGAACTAGAGACCCGAGGG - Intergenic
1154157684 18:11956752-11956774 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1155561345 18:27080687-27080709 CACTGGAACTAGGGGCAAGTAGG + Intronic
1156294120 18:35774482-35774504 CACTGGGAGTAGAGGACACAGGG - Intergenic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1159650751 18:70974538-70974560 CACTGGAACTATAAACCAGTAGG - Intergenic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1162190014 19:8937636-8937658 CCCTGGAACTAGTGACCAGAGGG + Exonic
1163054215 19:14706185-14706207 CCCTGGACACAGAGGCCAGAGGG + Intronic
1165760719 19:38319867-38319889 AACTGGAACTAGGTGCCAGACGG + Exonic
928069300 2:28198619-28198641 CACTGGAGCTAAAGGCAAGGGGG - Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932105588 2:68938270-68938292 CAGTGGAACTAGATGCTTGAAGG - Intergenic
934963949 2:98703641-98703663 CACTGGATATGGAGGCCACAGGG - Intronic
936501894 2:113073181-113073203 CACTGGGAGTAAAGGCCACAGGG - Intronic
937881954 2:126875084-126875106 TACTGAAACTAGAGGCAAGGGGG - Intergenic
939562824 2:143752170-143752192 CACTGGTAATAGAGGCCAGCTGG - Intronic
940183646 2:150960272-150960294 CCCTAGACCCAGAGGCCAGAAGG + Intergenic
943772359 2:191732334-191732356 GACTGGAAATGGTGGCCAGAGGG + Intergenic
945483200 2:210365793-210365815 TACTGAAACTAGAGGCAAGGGGG + Intergenic
946011278 2:216565620-216565642 TACTGAAACTAGAGGCAAGGGGG + Intronic
946559508 2:220896961-220896983 GTCTGGAAGGAGAGGCCAGAAGG - Intergenic
947293971 2:228610186-228610208 CACATGATCTAAAGGCCAGATGG + Intergenic
948165830 2:235861817-235861839 TACTGGAACTAGTGACCAGATGG - Intronic
1169215962 20:3795008-3795030 TCCTGGAACAAGAGGCCTGAAGG - Intronic
1171230915 20:23484287-23484309 GACAGGAACTGGAGGCCACAGGG - Intergenic
1172490804 20:35336182-35336204 CACAGGCTCTAGAGTCCAGAAGG + Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173641293 20:44603991-44604013 CTCTTGAAGTAGAGGACAGAGGG + Intronic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1178038797 21:28615708-28615730 CACTAGAACTACAGTCCATATGG + Intergenic
1179285618 21:39975161-39975183 CACTGGATCTAGAGCCCACTTGG + Intergenic
1180249434 21:46571362-46571384 ATCAGAAACTAGAGGCCAGAAGG + Intergenic
1180785451 22:18544605-18544627 GACTGGAACAAGATTCCAGAAGG + Intergenic
1181242354 22:21483958-21483980 GACTGGAACAAGATTCCAGAAGG + Intergenic
1184569159 22:45310961-45310983 CACTGGAAATAGAGATGAGACGG + Intronic
1184658264 22:45952881-45952903 GCCTGGAACTAGAGGCCTCATGG + Intronic
1184897083 22:47415882-47415904 GACTGGAACTGGTGGCTAGATGG - Intergenic
1185045256 22:48525459-48525481 CACTGGAAGCAGAGTCCAGAAGG - Intronic
949397945 3:3635009-3635031 CTCTGGAAGCAGATGCCAGATGG - Intergenic
949700564 3:6752261-6752283 CTCTGGAACTAGAACCAAGATGG + Intergenic
951844183 3:27067893-27067915 ACCTGGACCTAGAGGCCACAGGG - Intergenic
952821503 3:37490243-37490265 TACTGAAACTAGAGGCAAGGGGG + Intronic
952935562 3:38395845-38395867 CACTGGCACTAGATGTGAGAAGG - Intronic
953793904 3:45968269-45968291 CACAGGAGCTTGAGGCCACACGG - Exonic
953908237 3:46879073-46879095 CACTTTAACCAGAGGCCCGAGGG + Intronic
955077004 3:55623493-55623515 TACTGAAACTAGAAGCAAGAGGG - Intronic
955408785 3:58642651-58642673 CACTTAAACAGGAGGCCAGAGGG - Intronic
956866764 3:73376799-73376821 CACTGTAAGCAGAGGCCACAAGG - Intergenic
965403939 3:168248399-168248421 CACTGAAACTAAGAGCCAGATGG + Intergenic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
969431889 4:7160141-7160163 CACTGGAATTAGGAGGCAGAGGG + Intergenic
970167410 4:13253872-13253894 CACTGAAACTAGAGATGAGAAGG + Intergenic
970242036 4:14019637-14019659 CACAGGAACTAGGATCCAGATGG - Intergenic
970940006 4:21620872-21620894 GACTGGAGATAGAGGTCAGAAGG - Intronic
974756885 4:66220934-66220956 GACAGGAACTACAGGCAAGAAGG + Intergenic
980305922 4:131061402-131061424 CACAGACACCAGAGGCCAGAGGG + Intergenic
980570054 4:134602891-134602913 CAGTGGAACAAGAGAACAGATGG + Intergenic
981472239 4:145149715-145149737 TAATGGAACTAAAGACCAGAGGG + Intronic
982973657 4:162023835-162023857 CTCTGAAGCCAGAGGCCAGAAGG - Intronic
983222446 4:165055628-165055650 CGCTGGAAGATGAGGCCAGAGGG + Intergenic
983473733 4:168188898-168188920 GACTGAAACCAGAGGCAAGATGG + Intergenic
983674003 4:170270811-170270833 TACTGAAACTAGAAGCAAGAGGG - Intergenic
987114580 5:14715905-14715927 CAGGGGAACCTGAGGCCAGATGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
992065557 5:73104523-73104545 CACTGGAAGTAAAGGCCTCAGGG - Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
995142933 5:108753856-108753878 CAGTTGAACTAGAGTCCATATGG + Intronic
995407663 5:111819101-111819123 TACTGAAACTAGAGGCAAGCAGG - Intronic
995850898 5:116544923-116544945 TACTGAAACTAGAAGCAAGAAGG - Intronic
997574404 5:134962873-134962895 CACTGAAGCTAGAAGCTAGAAGG + Intronic
999124618 5:149238085-149238107 CACTGGGGCTAAAGGCCAGGTGG - Intronic
999923378 5:156347257-156347279 CACTGGGACTTAAGGCCAAATGG - Intronic
1000381211 5:160631202-160631224 CACTTGCACAAGAGGCCACAGGG - Intronic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001636164 5:173211801-173211823 CACTGGCTGTAGAGGCCAGAGGG + Intergenic
1003255467 6:4471359-4471381 TACTGAAACTAGAGGCAAGGGGG - Intergenic
1003299532 6:4865052-4865074 TACTGAAACTAGAGGCAAGGGGG - Intronic
1005468818 6:26141792-26141814 AGCTGGAACTAGTGGGCAGAGGG - Intergenic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1006798397 6:36744858-36744880 CTCTGCAGCCAGAGGCCAGAAGG + Intronic
1007944596 6:45814316-45814338 CTCTGGAAGTAGAGCCAAGAAGG + Intergenic
1012920117 6:105212752-105212774 CACTGGAACATGAGGCCAATGGG + Intergenic
1013054041 6:106565610-106565632 CACTGCAACTACAGGCTGGATGG + Intronic
1015447335 6:133321900-133321922 CTCTGGACGTAGAGGCCCGAGGG + Intronic
1016572900 6:145534898-145534920 CACTGGACCTAGAGGTGAGGTGG - Intronic
1016782633 6:147976754-147976776 GAGTGGAACTGGAGGCCCGAAGG + Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1025028162 7:55535064-55535086 CCCTGGCACTAGAGGCCATGCGG - Intronic
1026135864 7:67660188-67660210 CACCAGAACTGGAGGCCAGCAGG + Intergenic
1028832245 7:95340821-95340843 CCTTTGAACTAGAAGCCAGAAGG - Intergenic
1034734026 7:153412426-153412448 CACTTGAAGCAGACGCCAGACGG + Intergenic
1036104199 8:5822808-5822830 CACTGAAACTAGAAGCAAGGGGG + Intergenic
1042117753 8:65450632-65450654 GGCTGGAAATAGAGCCCAGAGGG - Intergenic
1045016360 8:98004664-98004686 GACTGGGACAAGAGGCCGGAGGG + Intronic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048608226 8:135992334-135992356 TACTGCAACTAAAGGCTAGAGGG - Intergenic
1049956983 9:702720-702742 CACTGAAACTAGGGGCTAAAAGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1055396739 9:75883781-75883803 GACTGGAAGTAGAAGCTAGAAGG + Intergenic
1057349248 9:94280936-94280958 TACTGAAACTAGAGGCAAGGGGG + Intronic
1058776631 9:108290582-108290604 CAATGGAACCAGAAGCTAGAGGG + Intergenic
1060671131 9:125470855-125470877 CTCTGGAACTAGAAGTCAGTGGG - Intronic
1061040046 9:128136004-128136026 CAAGGGCCCTAGAGGCCAGATGG - Intergenic
1061661245 9:132131707-132131729 CTCAGGAACTTGAAGCCAGAAGG - Intergenic
1187297346 X:18014797-18014819 CACTGAAGCTGGAGTCCAGAAGG + Intergenic
1192557667 X:72103287-72103309 CACTGGGATTTCAGGCCAGAGGG + Intergenic
1194530763 X:95045569-95045591 CACTGGCACCAAAGGCCACAGGG - Intergenic
1198441365 X:136666604-136666626 CACTGGAAATTGAGGCCAAAGGG - Exonic
1198910462 X:141607520-141607542 GACTGGACCTTGAGGCCAGAAGG + Intronic
1199904560 X:152211946-152211968 CACTGGAGTCACAGGCCAGAAGG + Intronic
1201296690 Y:12469444-12469466 TACTGAAACTAGAGGCAAGGGGG + Intergenic
1201607934 Y:15808523-15808545 CACTGAAGCTAAAGACCAGAAGG + Intergenic
1202297402 Y:23374529-23374551 TACTGAAGCTAGAGGCAAGAGGG + Intergenic
1202573405 Y:26296068-26296090 TACTGAAGCTAGAGGCAAGAGGG - Intergenic