ID: 1172982154

View in Genome Browser
Species Human (GRCh38)
Location 20:38951530-38951552
Sequence ATCTTTAAGTTTTACATGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172982151_1172982154 6 Left 1172982151 20:38951501-38951523 CCTTACCAGCTGCTGTTTGTTTC 0: 1
1: 0
2: 2
3: 26
4: 240
Right 1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG 0: 1
1: 0
2: 2
3: 18
4: 264
1172982152_1172982154 1 Left 1172982152 20:38951506-38951528 CCAGCTGCTGTTTGTTTCTTTTT 0: 1
1: 0
2: 14
3: 333
4: 3935
Right 1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG 0: 1
1: 0
2: 2
3: 18
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172982154 Original CRISPR ATCTTTAAGTTTTACATGGA CGG Exonic
904785317 1:32978146-32978168 ATTTTTAAGGTTTCCAAGGATGG - Intergenic
906134298 1:43485290-43485312 ATATTTAACTTTTAAATGAATGG + Intergenic
907762259 1:57372863-57372885 TTCTTTAAGGTAGACATGGAAGG - Intronic
908371111 1:63478466-63478488 TTATTTCAGATTTACATGGATGG - Intronic
908479172 1:64520276-64520298 ATGTTTAAGTTTACCAGGGATGG + Intronic
909006904 1:70287458-70287480 ATCTTTATATTTTACATTTAAGG - Intronic
910487151 1:87727823-87727845 ATCTTTAAGGTACACATGGTAGG + Intergenic
910595431 1:88975511-88975533 ATTTTAAAGTTTCACGTGGAAGG + Intronic
911488549 1:98533211-98533233 ATCTTTGGGCCTTACATGGATGG - Intergenic
911719022 1:101169616-101169638 ATCTTTAAGGTTTTCAGGCATGG + Intergenic
911782304 1:101897392-101897414 ATGGTTAAGTTTTACATGGCAGG + Intronic
911885527 1:103293235-103293257 ATATTTTAGTTTTATATGAAAGG + Intergenic
916503070 1:165403528-165403550 ATCTTTAATTTTTCCATGTAGGG - Intronic
918296803 1:183164861-183164883 ACTTTTTAGTTTTACAAGGAAGG + Intergenic
918739303 1:188107019-188107041 ACCTTAAAGTTTTAGATGTAGGG - Intergenic
921493596 1:215809213-215809235 ATCTTAAAGTTTACCATAGAGGG - Intronic
923039803 1:230311450-230311472 ATTTTTAAGTTTTAGAGGCAGGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063019721 10:2115763-2115785 ATCTTTATGTACTACAGGGAGGG - Intergenic
1065500434 10:26376232-26376254 ATCTTTAATTCTTACATATAGGG + Intergenic
1067699677 10:48560627-48560649 AGCTTTCAGTTTTCCATAGATGG + Intronic
1068407287 10:56606130-56606152 ATATTTAAGTTTTAAAGGCAAGG + Intergenic
1070084106 10:73218299-73218321 ATCTTTCATTTTTTCATGAAAGG + Intronic
1070874312 10:79788181-79788203 ATCTTTAGTTTTCACATGTATGG + Intergenic
1071251768 10:83826237-83826259 CTCTTCAAGTTCTGCATGGAAGG - Intergenic
1071555565 10:86598764-86598786 ATCTGCAAGTGTTACAGGGAAGG + Intergenic
1071641243 10:87310334-87310356 ATCTTTAGTTTTCACATGTATGG + Intergenic
1073822389 10:107279470-107279492 ATCTTTATGCTTTACCAGGAGGG + Intergenic
1073838957 10:107476280-107476302 ATGTTCAATCTTTACATGGATGG + Intergenic
1074378823 10:112961542-112961564 ATCTTTATGTTTTACAGGGAAGG + Intronic
1074624477 10:115165085-115165107 ATATTTAAGTTGTACATATATGG - Intronic
1074735108 10:116422961-116422983 ATATTTAAATTTTACATGACAGG - Intergenic
1076553832 10:131308524-131308546 TTCTTTAAGTTTTAGAATGATGG - Intronic
1077195441 11:1277499-1277521 AACTTTGATTTTTATATGGAAGG - Intronic
1078193691 11:9116323-9116345 ATGTTTAAGTTTAACAAGGCAGG - Intronic
1078818666 11:14853162-14853184 ATTTTGAAATTTTAGATGGAAGG - Intronic
1080293173 11:30694298-30694320 ATCTTTAAATTGCACTTGGATGG + Intergenic
1080702952 11:34660113-34660135 ATCTTTATGTTTTAAATGTTAGG + Intronic
1080819971 11:35796443-35796465 ATGTTTAAGATTTCTATGGAAGG + Intronic
1086644006 11:89196560-89196582 ATATGTAAGTTTTACAATGAAGG - Intronic
1086683792 11:89707007-89707029 ATGTTTATGTTGTACAAGGATGG - Intergenic
1087496139 11:98893253-98893275 AACTTACAGTTTTACATGGCTGG + Intergenic
1088687442 11:112296854-112296876 GTCTTGAAGTTTTACATGAAAGG - Intergenic
1096484782 12:51972046-51972068 GTTTTTAGGTTTTACATTGAGGG + Intronic
1098091016 12:66901088-66901110 ATTTTTAAGTTTAAAATGAAAGG + Intergenic
1098123024 12:67263062-67263084 GTCTTACAGTTTTACATAGAGGG - Intergenic
1098453583 12:70647670-70647692 AGGTTTAAGTATTATATGGAAGG + Intronic
1099930523 12:89068917-89068939 GTATTTAAGTATTACATGCAGGG - Intergenic
1101838837 12:108313279-108313301 AGCTTTTTGTTTTCCATGGAAGG - Intronic
1102404896 12:112664666-112664688 AACTTCAAGTTTTGAATGGAAGG + Intronic
1103249161 12:119485251-119485273 AGCTAGAAGTTTAACATGGATGG + Intronic
1103477072 12:121226698-121226720 ATCTTAAAGTATTACATGTGAGG + Intronic
1104996190 12:132658922-132658944 GTTTTTAAGTTTTACATACACGG + Intronic
1107232654 13:38129260-38129282 ATTTTTCAGTTTTACATTTAAGG + Intergenic
1108913878 13:55585143-55585165 ATCATTAATTTTTACAAGAATGG + Intergenic
1110071301 13:71182415-71182437 ATATTTAAGTTGTCCATAGATGG - Intergenic
1110534290 13:76632924-76632946 AGCTGCAAGTGTTACATGGAAGG - Intergenic
1113660071 13:112101021-112101043 TTCTTTAAATTTTAAATGGTCGG + Intergenic
1115677714 14:35698116-35698138 ATCTTTAAATTTATCATAGAAGG + Intronic
1115775972 14:36715673-36715695 TGCTTTAATTTTTACATGAAGGG + Intronic
1115813192 14:37133055-37133077 ATCTTTAAGTATTACAGATAAGG + Intronic
1116533041 14:45996446-45996468 ATTTTTAAATTGTACATGCATGG + Intergenic
1117279961 14:54229975-54229997 AACTTTAAGTTTTACACAAAAGG + Intergenic
1117558243 14:56908622-56908644 ATTTTTTAGTTTTATAGGGATGG + Intergenic
1118197487 14:63641173-63641195 ATCTTTTAATTTTACATCCATGG + Intronic
1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG + Intronic
1120699390 14:87681862-87681884 AACTTCCACTTTTACATGGAAGG - Intergenic
1121144076 14:91568444-91568466 GTCTTTAAGTTTTTCATATACGG - Intergenic
1122472646 14:101981875-101981897 AAATTTAAGTTTTACATTCATGG - Intronic
1123872137 15:24587141-24587163 CTCATTAAGTTTTGCATAGAAGG - Intergenic
1124662512 15:31562024-31562046 ATTTTTAATTTTTACAGAGATGG + Intronic
1128007863 15:64262019-64262041 ATCTTAAAGTTTAAAATGAAAGG + Intronic
1128419535 15:67478455-67478477 TTTTTTAAGTTGTGCATGGATGG - Intronic
1129520456 15:76182828-76182850 ATCCTGTAGTTTTTCATGGAGGG + Intronic
1130358007 15:83152811-83152833 ATTTTTACTTTTTACATGAAGGG + Intronic
1131203569 15:90421964-90421986 ATATTTAAGTTTTATAAGAAAGG + Intronic
1132016611 15:98323168-98323190 ATCTTTAATTTCCACCTGGATGG - Intergenic
1134834343 16:17348369-17348391 ATCTTTATACTTGACATGGAAGG - Intronic
1135275872 16:21112317-21112339 ATATTTCAGTTTTTCAAGGATGG + Intronic
1137858733 16:51823592-51823614 AACTTGAGGTTTTACATGTATGG + Intergenic
1138511049 16:57508559-57508581 ATCTTTAAGTGTTAGAGGGGAGG - Intergenic
1143422972 17:6810441-6810463 ATTTTTAAATTTTAAATGGTTGG + Intronic
1144175330 17:12699693-12699715 ATCTTTAAGCTTTAAATTAAAGG + Intronic
1145800726 17:27683040-27683062 CTCTTAAAGATTTATATGGAGGG + Intergenic
1146132346 17:30289419-30289441 ATATTTAACTTTTTCATGAATGG + Exonic
1146826923 17:36031157-36031179 ATATTTTACTTTTAAATGGAAGG - Intergenic
1147510681 17:41066381-41066403 ATCTTTAAGTGAGTCATGGAAGG - Intergenic
1148510444 17:48164612-48164634 ATCTTTATTTTTTTCCTGGAAGG - Intronic
1149108357 17:52996560-52996582 ATGTTTAATTTTTATATGCATGG - Intergenic
1150673144 17:67219991-67220013 ATCTGTAAGTTTGACAGAGATGG - Intronic
1150931485 17:69590046-69590068 ATACTTAAGCTTCACATGGACGG - Intergenic
1153740171 18:8117046-8117068 TTTATTAAGTTCTACATGGACGG + Intronic
1153899432 18:9603467-9603489 AACTTTAAGTTTTATATTAACGG + Intronic
1155359459 18:24985559-24985581 ATCTCTAAGTTTTCCAAGAATGG + Intergenic
1156991679 18:43416375-43416397 ATGTTTCAGGTTTACCTGGAAGG + Intergenic
1157002954 18:43549425-43549447 GTCTTTCAGTTTCACATGGCTGG + Intergenic
1158153945 18:54404321-54404343 ATCTCTAAGTTTTAACTAGAAGG + Intergenic
1158387679 18:57013386-57013408 ATTTTAAAATTGTACATGGAAGG - Intronic
1159513373 18:69425994-69426016 ACTTTTAATTTTTACATGTAAGG + Intronic
1159664285 18:71138960-71138982 ATCTTTAAGTTTTAATAGAAAGG - Intergenic
1160727994 19:626448-626470 ATATTTAAGCTATACATGGCTGG - Intronic
1161902205 19:7127225-7127247 GCTTTTAAGTGTTACATGGATGG - Intronic
1164124049 19:22294094-22294116 AATTTTAAGTTTTACATTTAAGG + Intronic
925218667 2:2120287-2120309 AGCTTTAAGGTGTACATGGCTGG - Intronic
926970994 2:18467208-18467230 ATATGTATGTTTTATATGGAGGG - Intergenic
929348563 2:40918636-40918658 ATCTTTAAGAATTACATGATTGG - Intergenic
930273932 2:49289511-49289533 ATCTTAAAGGTTAATATGGATGG + Intergenic
930464327 2:51726884-51726906 ATCTTTAAATTTTACATTAATGG + Intergenic
930850362 2:55953415-55953437 ATCTTTTTTTTTTACATGAAGGG + Intergenic
933020478 2:77184333-77184355 ATTTTTAAGTCTCACAGGGAAGG + Intronic
933157152 2:78988995-78989017 AGCTTTAGTTTTTACATTGAAGG - Intergenic
933160536 2:79019146-79019168 AGATTTCTGTTTTACATGGAGGG - Intergenic
933497972 2:83075364-83075386 ATCATTGTGTTTTACAGGGATGG - Intergenic
934545464 2:95211359-95211381 ACGTTCAAGTTTTACATTGAAGG + Intronic
936761987 2:115797587-115797609 ATCTTTGTCATTTACATGGATGG + Intronic
937392262 2:121499584-121499606 ATTTTTAATTTTTAAATGAACGG + Intronic
938095494 2:128458814-128458836 ATGTTTAATTTTCACATGGATGG - Intergenic
938957493 2:136312497-136312519 AAATTTAAGTTTTAGATAGAAGG - Intergenic
939775855 2:146387129-146387151 ATTTTTAAATTTTACATGAAAGG + Intergenic
940077023 2:149753696-149753718 TACTTTAAATTTTATATGGAAGG + Intergenic
940689859 2:156902630-156902652 ATCTTTAATATTTCCATGTATGG + Intergenic
940998413 2:160175545-160175567 ATTTTTATGCTTTTCATGGATGG + Intronic
942620265 2:177837635-177837657 ATCTAGAAGTTGTTCATGGAAGG - Intronic
942872436 2:180751228-180751250 ATCTATAATTTTTGTATGGAGGG + Intergenic
943008262 2:182413357-182413379 ATCATTAAATTTTAAATGGGAGG + Intronic
944432590 2:199650072-199650094 ATCTGTGAGTTTTACATGTATGG + Intergenic
944826311 2:203486668-203486690 ATATTTTAGTTTTTCATGCATGG - Intronic
946616334 2:221514641-221514663 ATTTATAATTTATACATGGAAGG - Intronic
948053340 2:234994308-234994330 ATGTTAAATATTTACATGGATGG + Intronic
948078293 2:235184187-235184209 ACCTTTAAGTTTTACGAGGTTGG - Intergenic
1169976194 20:11331146-11331168 ATCTATATGATTTACATAGATGG + Intergenic
1170618928 20:17977956-17977978 AGCTTCAAGGTTTACATGAACGG - Intronic
1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG + Exonic
1174410943 20:50335006-50335028 GGTTTTAAGTTGTACATGGATGG + Intergenic
1177074496 21:16554988-16555010 TTCTTTTTGTTTTATATGGATGG + Intergenic
1177340393 21:19791569-19791591 ATCTTTCAGTTTTACTTGGAAGG - Intergenic
1177548392 21:22589601-22589623 ATATTAAAGTCTTTCATGGATGG + Intergenic
1178889917 21:36512634-36512656 TGCTTTAATTTTTACATAGATGG - Intronic
1182133505 22:27878099-27878121 ATCATTAAGTTTTAAATGCATGG + Intronic
1182290604 22:29276150-29276172 GTCTATAAGATTTACAAGGAGGG - Intronic
1182309010 22:29391595-29391617 AGCTTTAAGATTTCCAAGGAGGG + Intronic
1182863492 22:33581912-33581934 ATCTTAAAGCTTCACATGGCTGG + Intronic
1184606401 22:45577075-45577097 ATCATCAAGCGTTACATGGACGG + Exonic
949334891 3:2963630-2963652 TTCTTTAGGTTAAACATGGAAGG - Intronic
951047123 3:18052405-18052427 GATTTTAAGTTTTACATGTATGG + Intronic
952245460 3:31585378-31585400 ATTTTTAAGTTATATAAGGAAGG - Intronic
952645797 3:35657261-35657283 CTCTTTAAGTTGTGAATGGATGG - Intronic
956560570 3:70569963-70569985 AACTTGCAGTTTTACATGGCTGG + Intergenic
957649700 3:82983689-82983711 ATTTTTAAGCTTTTCATAGAGGG - Intergenic
959326381 3:104942259-104942281 ATCTTGAATTTTTAAATAGAAGG - Intergenic
959426320 3:106193250-106193272 GTCGTTAAGTTTTTCTTGGATGG - Intergenic
959856571 3:111165660-111165682 CTTTTTAAGTTTTACAGGCAGGG - Intronic
960277597 3:115745266-115745288 ATCTTTTAGTTTAACTTGAAGGG - Intergenic
960976073 3:123175525-123175547 ATCTTTAAGTTTTATTTCAATGG - Intronic
961880147 3:130056113-130056135 AGCTTTAATTTTGATATGGAAGG + Intergenic
962112383 3:132466841-132466863 ATGTTTAATTTTTCCATGGATGG - Intronic
962328804 3:134459408-134459430 ATTTTTAATTTTGACATGTAAGG + Intergenic
962895369 3:139709204-139709226 ATTTTTAATTTTTTTATGGAGGG + Intergenic
962897678 3:139730845-139730867 ATCTTTAGGTTTTGCCAGGATGG + Intergenic
963457682 3:145565721-145565743 ATATTCAAGTTATACATGGGAGG - Intergenic
964395296 3:156239299-156239321 ATCTTTACATTTAACATGAAAGG - Intronic
964444401 3:156743651-156743673 ATGTTTAACTTTTATATGAAGGG + Intergenic
965054681 3:163697715-163697737 ATCCTTTAGTTTAACATGAACGG + Intergenic
967596553 3:191331413-191331435 ATCTTGCATTTTTATATGGAAGG - Intronic
969939316 4:10714328-10714350 CTGTTTAAGTTTTTCATGGAGGG - Intergenic
970013488 4:11486344-11486366 CTCTAAGAGTTTTACATGGATGG + Intergenic
970632081 4:17958407-17958429 ATCTTTTATTTTTAAATTGAAGG - Intronic
971206948 4:24580105-24580127 ATGTTAAAATTCTACATGGAGGG + Intronic
972491001 4:39587150-39587172 ATATTTTTGTTTTACATAGAAGG - Intronic
974127053 4:57709599-57709621 ATCTTTAGGTTATCCAGGGAGGG - Intergenic
974159638 4:58121243-58121265 ATCTTGAAGTTTTACCTGTTAGG - Intergenic
974219118 4:58943371-58943393 ATATTAAAGTTTTACAGAGATGG + Intergenic
974609548 4:64198328-64198350 ATTATTAAGTTTTACATGAGTGG - Intergenic
975339947 4:73227879-73227901 CTATTAAAGTTTTACATGAAGGG - Intronic
976487107 4:85620783-85620805 ATTTTTAAGTTTTAGATTCAAGG + Intronic
977056229 4:92195259-92195281 ATATTTAACTTTGAGATGGATGG - Intergenic
978086368 4:104660336-104660358 ATCTTGAACTATTACATGGTAGG - Intergenic
981848054 4:149192526-149192548 ATTTTTCAGTTTAACATAGATGG + Intergenic
981926018 4:150140128-150140150 ATGTTTATGTTTTCTATGGAGGG - Intronic
982688820 4:158525420-158525442 ATTTTTAAGTTTCAAATGGAAGG + Intronic
982921958 4:161287256-161287278 ATTTTTCAGTTTTACATGTAAGG + Intergenic
983028530 4:162768811-162768833 GTCTTTAGGTTTTACATACATGG + Intergenic
983574985 4:169251232-169251254 CCCTTTAGGTTTTACAGGGAGGG + Intronic
984043311 4:174765305-174765327 ATCTTTAAGTCTTAATGGGAAGG + Intronic
985348189 4:189029326-189029348 ATCTTTAAGTATTAGATGCTTGG + Intergenic
986412841 5:7498948-7498970 ATTTTTAAGATTTATATGAATGG - Intronic
987808193 5:22797636-22797658 ATCTTTTATTTCTACATAGATGG - Intronic
988557909 5:32254129-32254151 ATCTTTCAGTCTTTCATAGAGGG - Intronic
988892549 5:35634155-35634177 ATCTTTAAGTCCTAAATGAAAGG - Intronic
989991981 5:50776530-50776552 ATCTTTAAATGTTACATAAAGGG - Intronic
991240807 5:64458133-64458155 ATTTGTAAGTTTTAAATTGAGGG - Intergenic
991998057 5:72407937-72407959 ATGTTTAAATTCCACATGGATGG + Intergenic
992283269 5:75204459-75204481 TGCTTTAAGTTTTACTTGGTTGG + Intronic
993294484 5:86118514-86118536 ATATTTAATGTTTACCTGGAAGG + Intergenic
993689060 5:90976368-90976390 ATCTTTAAGTTTACCATGCATGG + Intronic
993957941 5:94260018-94260040 ATCTTTGAGTTTTATATCTATGG - Intronic
994022023 5:95038174-95038196 ATGTTTTAGTTATACCTGGAAGG - Intronic
995366318 5:111365426-111365448 AACTTCAACTTTCACATGGATGG - Intronic
1000367204 5:160502903-160502925 ATCTTAAAGTTCCACATGGCTGG + Intergenic
1000656163 5:163880767-163880789 ATCTTTAAAATATAAATGGAAGG - Intergenic
1000912338 5:167037622-167037644 TTCTGCAAGTTTTACATGGTTGG - Intergenic
1001351316 5:170968588-170968610 ATGAATATGTTTTACATGGATGG + Intronic
1001829707 5:174775460-174775482 ATCTTTACCTATTACCTGGAAGG + Intergenic
1003290132 6:4773612-4773634 ATCAGTGAGTTTTAAATGGAGGG + Intronic
1004712341 6:18184223-18184245 GCTTTTAAGTTTTACATGAATGG + Intronic
1007192965 6:40035698-40035720 ATCTATCAGTTTTCCATGGATGG - Intergenic
1007929489 6:45677539-45677561 ATCTTTATGTTTTTCTTTGACGG - Intergenic
1008375590 6:50787665-50787687 ATATTTAACTTAGACATGGAGGG + Intergenic
1009563484 6:65278068-65278090 ATCTTTCAGTTTAAGACGGAAGG - Intronic
1010651833 6:78464549-78464571 ATTTATACATTTTACATGGAAGG - Intergenic
1010936035 6:81862724-81862746 GTCTTTACTTTTTACTTGGAAGG + Intergenic
1011886699 6:92105573-92105595 ATCTATATGTTTTCCATAGATGG + Intergenic
1012446034 6:99307832-99307854 ATCTTAAAGGTTTATGTGGAGGG - Intronic
1012666359 6:101976014-101976036 ATCATTTAGTTTTGGATGGAGGG + Intronic
1013211443 6:107990480-107990502 TTCTTTAAGTTTTGCATGCAAGG - Intergenic
1013329069 6:109080604-109080626 AGTTTTAAGTTTTACCTTGAAGG + Intronic
1013797036 6:113899653-113899675 ATTTTTAAGTTTTATTGGGATGG - Intergenic
1013864991 6:114685133-114685155 ATCTTTGAGTTTTTCAAGGTTGG - Intergenic
1015299025 6:131631844-131631866 ATGTTTACGGTTTACATTGATGG + Intronic
1016389913 6:143564564-143564586 ATCTTTAACTGTTTCATGGAGGG - Intronic
1017081695 6:150675498-150675520 ATCTTTCAGTTATATTTGGAGGG + Intronic
1018436620 6:163765328-163765350 TTCTTTCCTTTTTACATGGAAGG + Intergenic
1018465871 6:164044069-164044091 ATTTTTTAGTTTTTCATAGATGG + Intergenic
1019495104 7:1334336-1334358 ATCCTTTTGTTTTAAATGGAGGG + Intergenic
1020869489 7:13609164-13609186 TTATTTAACTTTTACATAGATGG - Intergenic
1021015984 7:15534314-15534336 ATTTTAAAGATTTACATGAAAGG - Intronic
1022043044 7:26598680-26598702 AGTTTTAAATTTTACATGAATGG - Intergenic
1023365877 7:39462801-39462823 ACCCTTGAGTTCTACATGGAAGG + Intronic
1024394656 7:48851754-48851776 GTCTTTTATTTTTATATGGAGGG - Intergenic
1024400604 7:48920887-48920909 GTCTTTTATTTTTATATGGAGGG + Intergenic
1024427243 7:49240407-49240429 ATTTTTAAAATTTAAATGGATGG + Intergenic
1025771185 7:64509056-64509078 ATGCTGAACTTTTACATGGAGGG - Intergenic
1027415648 7:77971476-77971498 AGCTGTAAGTTTTTTATGGATGG + Intergenic
1027799673 7:82735439-82735461 ATCTTCAAGCTTTCCAGGGATGG - Intergenic
1028550426 7:92055960-92055982 AGATTTTTGTTTTACATGGATGG + Intronic
1029964722 7:104727450-104727472 AGCTTTGAGTTTTACATTTAAGG + Intronic
1030280820 7:107773473-107773495 ATCTTAGAGTATTCCATGGAGGG - Intronic
1030372819 7:108719652-108719674 ATCTTTTAATTTGGCATGGAAGG + Intergenic
1030949907 7:115777210-115777232 ATTTTTAAATTTTAAAGGGAGGG + Intergenic
1031020092 7:116618495-116618517 TTCTTTCTGTTTTACATGTAAGG - Intergenic
1031491430 7:122394570-122394592 CCCTTTAAGTCTTCCATGGAAGG - Intronic
1031884080 7:127227664-127227686 ATCAGGAAGTTTTCCATGGAAGG - Intronic
1034131346 7:148721027-148721049 CCCTTTAAGTTTTAAATGAATGG - Intronic
1035542218 8:449524-449546 CTTTTTAATTTCTACATGGAAGG + Intronic
1036000476 8:4597011-4597033 ATCTTACAGTTCTACATGGCTGG - Intronic
1036132199 8:6125951-6125973 GTCTTATACTTTTACATGGAAGG - Intergenic
1038100431 8:24367746-24367768 ATCTTTAAATTTTCCTTCGAGGG + Intergenic
1042317589 8:67440251-67440273 TTCTTTAAGTGATACATGGCTGG - Intronic
1044438632 8:92196343-92196365 ATCTTCAAGTTTTATCTGAAGGG + Intergenic
1044790599 8:95843002-95843024 ATTTTTAAATTTAACATGGGAGG + Intergenic
1046085801 8:109433641-109433663 ATCTTTAAATTCTACATTAATGG - Intronic
1046323160 8:112604654-112604676 AGCTTTAGGTTTTACATTTAAGG - Intronic
1046392299 8:113591272-113591294 ATTTTTCAGTTTTACAACGATGG + Intergenic
1046424942 8:114035017-114035039 TTTTTTAAGTATTACATGGGGGG + Intergenic
1046543450 8:115616453-115616475 ATATTTTGGTTTGACATGGATGG - Intronic
1047664175 8:127072239-127072261 ATCTGTAAGTTTTACACTGAGGG - Intergenic
1050362859 9:4847285-4847307 ATCTTTAATTATTAAAAGGATGG + Intronic
1051480034 9:17549756-17549778 AACTTGAAGTTTTCCAAGGATGG - Intergenic
1052580018 9:30343177-30343199 AGTTTTAAGTCTTACATGTAAGG + Intergenic
1052793687 9:32902482-32902504 ATATTTAAGCTGGACATGGATGG + Intergenic
1054838480 9:69706905-69706927 ATTTTTAAACTTTACATGAATGG + Intergenic
1055730899 9:79278482-79278504 ATCTCTTAGTTCTGCATGGATGG - Intergenic
1056601234 9:88048701-88048723 ATCTTCTAGTTCTACATGGCAGG + Intergenic
1056652364 9:88477186-88477208 AGCTTTGAGATTTACATGCAGGG - Exonic
1059860873 9:118460040-118460062 ATCTGTAAGATTCACAGGGATGG - Intergenic
1060168767 9:121443282-121443304 ATCTTTACATTGTGCATGGAGGG - Intergenic
1186535617 X:10344207-10344229 ATTTTTGAGTTTAACATTGAAGG + Intergenic
1187486581 X:19709813-19709835 TTCCTTAAGTTTAAGATGGATGG - Intronic
1187889427 X:23920297-23920319 ATATTTAAGTTTTAAAAAGATGG + Intronic
1188350704 X:29127657-29127679 ATCTTTAAATTTAATATGGCTGG + Intronic
1188502969 X:30848988-30849010 AAATTTAAGTTTTACCTTGAAGG - Intronic
1189012647 X:37062061-37062083 AACCTTAGGGTTTACATGGATGG + Intergenic
1189847923 X:45153401-45153423 ATATTTAAGTTTTAGATAAAGGG + Intronic
1190397746 X:50001815-50001837 AGGTTACAGTTTTACATGGAGGG - Intronic
1194829481 X:98603604-98603626 ATCACTAAGTTTTATATGGTTGG + Intergenic
1195175520 X:102311678-102311700 ATCTCTGATTTTTACATGTAAGG + Intronic
1195183344 X:102375415-102375437 ATCTCTGATTTTTACATGTAAGG - Intronic
1195305373 X:103576807-103576829 ATCTTTAAGTTGGACTAGGATGG + Intronic
1196303665 X:114074855-114074877 TTCTTTAAGTTTTAAAAAGAGGG + Intergenic
1196611484 X:117719655-117719677 ATATTTGAGTTTTAACTGGATGG - Intergenic
1197628218 X:128827423-128827445 ATCTTTAATGCTTATATGGAGGG + Intergenic
1199676516 X:150194337-150194359 ATTTTTAAGTTTTACATTCTGGG - Intergenic
1199826841 X:151508847-151508869 ATCTTTAAATTTAACCTGGCTGG - Intergenic
1200736871 Y:6809042-6809064 ATTTTTAAGTCTTAAAAGGAGGG - Intergenic
1201706166 Y:16939513-16939535 ATCATTAATTAATACATGGAAGG - Intergenic