ID: 1172992398

View in Genome Browser
Species Human (GRCh38)
Location 20:39046294-39046316
Sequence CTGGTAGGAGGCAGAAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992391_1172992398 18 Left 1172992391 20:39046253-39046275 CCAGTTTAATTAGCACTGGTGTC No data
Right 1172992398 20:39046294-39046316 CTGGTAGGAGGCAGAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992398 Original CRISPR CTGGTAGGAGGCAGAAATCT GGG Intergenic
No off target data available for this crispr