ID: 1172992483

View in Genome Browser
Species Human (GRCh38)
Location 20:39046862-39046884
Sequence GTTCATGCACAGATGGAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992480_1172992483 1 Left 1172992480 20:39046838-39046860 CCACAGCCTCTCTTGATTGATCT No data
Right 1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG No data
1172992479_1172992483 2 Left 1172992479 20:39046837-39046859 CCCACAGCCTCTCTTGATTGATC No data
Right 1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG No data
1172992481_1172992483 -5 Left 1172992481 20:39046844-39046866 CCTCTCTTGATTGATCTTGTTCA No data
Right 1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG No data
1172992478_1172992483 3 Left 1172992478 20:39046836-39046858 CCCCACAGCCTCTCTTGATTGAT No data
Right 1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992483 Original CRISPR GTTCATGCACAGATGGAATT CGG Intergenic
No off target data available for this crispr