ID: 1172992657

View in Genome Browser
Species Human (GRCh38)
Location 20:39047820-39047842
Sequence GGGCCAGGCGGGCCCCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992657_1172992666 -5 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992666 20:39047838-39047860 GGCCCTGGGGCTCGGGACACTGG No data
1172992657_1172992671 7 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992671 20:39047850-39047872 CGGGACACTGGAGTTTTCAGGGG No data
1172992657_1172992670 6 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992670 20:39047849-39047871 TCGGGACACTGGAGTTTTCAGGG No data
1172992657_1172992669 5 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992669 20:39047848-39047870 CTCGGGACACTGGAGTTTTCAGG No data
1172992657_1172992673 20 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992673 20:39047863-39047885 TTTTCAGGGGGAGCAGTGAGTGG No data
1172992657_1172992674 24 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992657_1172992672 8 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992672 20:39047851-39047873 GGGACACTGGAGTTTTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992657 Original CRISPR GGGCCAGGCGGGCCCCACTC CGG (reversed) Intergenic
No off target data available for this crispr