ID: 1172992664

View in Genome Browser
Species Human (GRCh38)
Location 20:39047832-39047854
Sequence TCCCGAGCCCCAGGGCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992664_1172992670 -6 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992670 20:39047849-39047871 TCGGGACACTGGAGTTTTCAGGG No data
1172992664_1172992671 -5 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992671 20:39047850-39047872 CGGGACACTGGAGTTTTCAGGGG No data
1172992664_1172992675 19 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992675 20:39047874-39047896 AGCAGTGAGTGGAAGGCTCGTGG No data
1172992664_1172992676 28 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992676 20:39047883-39047905 TGGAAGGCTCGTGGAGCTGCTGG No data
1172992664_1172992674 12 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992664_1172992669 -7 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992669 20:39047848-39047870 CTCGGGACACTGGAGTTTTCAGG No data
1172992664_1172992673 8 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992673 20:39047863-39047885 TTTTCAGGGGGAGCAGTGAGTGG No data
1172992664_1172992672 -4 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992672 20:39047851-39047873 GGGACACTGGAGTTTTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992664 Original CRISPR TCCCGAGCCCCAGGGCCAGG CGG (reversed) Intergenic
No off target data available for this crispr