ID: 1172992667

View in Genome Browser
Species Human (GRCh38)
Location 20:39047840-39047862
Sequence CTCCAGTGTCCCGAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992667_1172992676 20 Left 1172992667 20:39047840-39047862 CCCTGGGGCTCGGGACACTGGAG No data
Right 1172992676 20:39047883-39047905 TGGAAGGCTCGTGGAGCTGCTGG No data
1172992667_1172992675 11 Left 1172992667 20:39047840-39047862 CCCTGGGGCTCGGGACACTGGAG No data
Right 1172992675 20:39047874-39047896 AGCAGTGAGTGGAAGGCTCGTGG No data
1172992667_1172992674 4 Left 1172992667 20:39047840-39047862 CCCTGGGGCTCGGGACACTGGAG No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992667_1172992673 0 Left 1172992667 20:39047840-39047862 CCCTGGGGCTCGGGACACTGGAG No data
Right 1172992673 20:39047863-39047885 TTTTCAGGGGGAGCAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992667 Original CRISPR CTCCAGTGTCCCGAGCCCCA GGG (reversed) Intergenic
No off target data available for this crispr