ID: 1172992674

View in Genome Browser
Species Human (GRCh38)
Location 20:39047867-39047889
Sequence CAGGGGGAGCAGTGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172992657_1172992674 24 Left 1172992657 20:39047820-39047842 CCGGAGTGGGGCCCGCCTGGCCC No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992662_1172992674 13 Left 1172992662 20:39047831-39047853 CCCGCCTGGCCCTGGGGCTCGGG No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992665_1172992674 9 Left 1172992665 20:39047835-39047857 CCTGGCCCTGGGGCTCGGGACAC No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992668_1172992674 3 Left 1172992668 20:39047841-39047863 CCTGGGGCTCGGGACACTGGAGT No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992664_1172992674 12 Left 1172992664 20:39047832-39047854 CCGCCTGGCCCTGGGGCTCGGGA No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992656_1172992674 25 Left 1172992656 20:39047819-39047841 CCCGGAGTGGGGCCCGCCTGGCC No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data
1172992667_1172992674 4 Left 1172992667 20:39047840-39047862 CCCTGGGGCTCGGGACACTGGAG No data
Right 1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172992674 Original CRISPR CAGGGGGAGCAGTGAGTGGA AGG Intergenic
No off target data available for this crispr