ID: 1173000564

View in Genome Browser
Species Human (GRCh38)
Location 20:39102472-39102494
Sequence GGGTGCATCAAGTCTCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173000564_1173000568 -8 Left 1173000564 20:39102472-39102494 CCCTACTGAGACTTGATGCACCC No data
Right 1173000568 20:39102487-39102509 ATGCACCCCTCACCAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173000564 Original CRISPR GGGTGCATCAAGTCTCAGTA GGG (reversed) Intergenic
No off target data available for this crispr