ID: 1173002588

View in Genome Browser
Species Human (GRCh38)
Location 20:39115229-39115251
Sequence GATTTCTGCAGAAACGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173002588_1173002590 25 Left 1173002588 20:39115229-39115251 CCAGAGGCGTTTCTGCAGAAATC No data
Right 1173002590 20:39115277-39115299 AAACCACTGCATTAGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173002588 Original CRISPR GATTTCTGCAGAAACGCCTC TGG (reversed) Intergenic
No off target data available for this crispr