ID: 1173004748

View in Genome Browser
Species Human (GRCh38)
Location 20:39131368-39131390
Sequence TAGGGAAAGACAGCGGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173004743_1173004748 13 Left 1173004743 20:39131332-39131354 CCTCTTAAAGATATTGTGAGCAT No data
Right 1173004748 20:39131368-39131390 TAGGGAAAGACAGCGGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173004748 Original CRISPR TAGGGAAAGACAGCGGGTGT TGG Intergenic
No off target data available for this crispr