ID: 1173007913

View in Genome Browser
Species Human (GRCh38)
Location 20:39155320-39155342
Sequence TGGCTGGAAGGTCAATCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173007907_1173007913 5 Left 1173007907 20:39155292-39155314 CCTCTTCACCATCTGGGTGAGTC No data
Right 1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG No data
1173007904_1173007913 16 Left 1173007904 20:39155281-39155303 CCACAGTAAGGCCTCTTCACCAT No data
Right 1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG No data
1173007903_1173007913 25 Left 1173007903 20:39155272-39155294 CCAGATAATCCACAGTAAGGCCT No data
Right 1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG No data
1173007908_1173007913 -3 Left 1173007908 20:39155300-39155322 CCATCTGGGTGAGTCAATCCTGG No data
Right 1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173007913 Original CRISPR TGGCTGGAAGGTCAATCCTT AGG Intergenic
No off target data available for this crispr