ID: 1173017092

View in Genome Browser
Species Human (GRCh38)
Location 20:39235543-39235565
Sequence CCAAATACGGACAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173017092_1173017101 3 Left 1173017092 20:39235543-39235565 CCCGCCTCCTTGTCCGTATTTGG No data
Right 1173017101 20:39235569-39235591 TTGCTTCCACAGGCAGAATCTGG No data
1173017092_1173017100 -7 Left 1173017092 20:39235543-39235565 CCCGCCTCCTTGTCCGTATTTGG No data
Right 1173017100 20:39235559-39235581 TATTTGGGGCTTGCTTCCACAGG No data
1173017092_1173017102 4 Left 1173017092 20:39235543-39235565 CCCGCCTCCTTGTCCGTATTTGG No data
Right 1173017102 20:39235570-39235592 TGCTTCCACAGGCAGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173017092 Original CRISPR CCAAATACGGACAAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr