ID: 1173017502

View in Genome Browser
Species Human (GRCh38)
Location 20:39238876-39238898
Sequence GTGTGTTTATTTTGGACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173017500_1173017502 3 Left 1173017500 20:39238850-39238872 CCAATGTGGGTCACTGAGCACTA No data
Right 1173017502 20:39238876-39238898 GTGTGTTTATTTTGGACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173017502 Original CRISPR GTGTGTTTATTTTGGACCAC TGG Intergenic
No off target data available for this crispr