ID: 1173018208

View in Genome Browser
Species Human (GRCh38)
Location 20:39245748-39245770
Sequence CAGTTTTCACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173018202_1173018208 1 Left 1173018202 20:39245724-39245746 CCAGAGGCAGAAGGAGTAGGGAG No data
Right 1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG No data
1173018201_1173018208 2 Left 1173018201 20:39245723-39245745 CCCAGAGGCAGAAGGAGTAGGGA No data
Right 1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173018208 Original CRISPR CAGTTTTCACAGAGGGAGGA GGG Intergenic
No off target data available for this crispr