ID: 1173019423

View in Genome Browser
Species Human (GRCh38)
Location 20:39254655-39254677
Sequence ACAGCAAGTAAGTGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173019420_1173019423 18 Left 1173019420 20:39254614-39254636 CCCTGAGTTCTGGGGAGATTAGG No data
Right 1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG No data
1173019422_1173019423 17 Left 1173019422 20:39254615-39254637 CCTGAGTTCTGGGGAGATTAGGT No data
Right 1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173019423 Original CRISPR ACAGCAAGTAAGTGCAGAGC TGG Intergenic
No off target data available for this crispr