ID: 1173019961

View in Genome Browser
Species Human (GRCh38)
Location 20:39258827-39258849
Sequence GGGTTGGTATTCTTCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173019955_1173019961 6 Left 1173019955 20:39258798-39258820 CCTTTATGCAGATGCAGAGTCCC No data
Right 1173019961 20:39258827-39258849 GGGTTGGTATTCTTCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173019961 Original CRISPR GGGTTGGTATTCTTCATCTC TGG Intergenic
No off target data available for this crispr