ID: 1173020476

View in Genome Browser
Species Human (GRCh38)
Location 20:39263692-39263714
Sequence GGAGAACAGCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173020471_1173020476 3 Left 1173020471 20:39263666-39263688 CCAGATCTCATGGTAACTCACTA No data
Right 1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173020476 Original CRISPR GGAGAACAGCACCAAGGGGA TGG Intergenic
No off target data available for this crispr