ID: 1173021352

View in Genome Browser
Species Human (GRCh38)
Location 20:39270116-39270138
Sequence CAAAAGAGAGCCTGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173021352_1173021357 21 Left 1173021352 20:39270116-39270138 CCTCTGTGCCAGGCTCTCTTTTG No data
Right 1173021357 20:39270160-39270182 CACATGACAGAAAAAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173021352 Original CRISPR CAAAAGAGAGCCTGGCACAG AGG (reversed) Intergenic
No off target data available for this crispr