ID: 1173021484

View in Genome Browser
Species Human (GRCh38)
Location 20:39271320-39271342
Sequence CAGGATCCTGGATGTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173021478_1173021484 -2 Left 1173021478 20:39271299-39271321 CCTGTCGAGGAGCTCTCATTCCA No data
Right 1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG No data
1173021473_1173021484 28 Left 1173021473 20:39271269-39271291 CCATTTTCCCTGGGCTCTGCCTG No data
Right 1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG No data
1173021477_1173021484 9 Left 1173021477 20:39271288-39271310 CCTGTCTGCGTCCTGTCGAGGAG No data
Right 1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG No data
1173021474_1173021484 21 Left 1173021474 20:39271276-39271298 CCCTGGGCTCTGCCTGTCTGCGT No data
Right 1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG No data
1173021475_1173021484 20 Left 1173021475 20:39271277-39271299 CCTGGGCTCTGCCTGTCTGCGTC No data
Right 1173021484 20:39271320-39271342 CAGGATCCTGGATGTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173021484 Original CRISPR CAGGATCCTGGATGTGGGCG TGG Intergenic
No off target data available for this crispr