ID: 1173022597

View in Genome Browser
Species Human (GRCh38)
Location 20:39279663-39279685
Sequence ATAAATAAACAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173022593_1173022597 27 Left 1173022593 20:39279613-39279635 CCACAGTTTGCCATTGCAATAGT No data
Right 1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG No data
1173022595_1173022597 17 Left 1173022595 20:39279623-39279645 CCATTGCAATAGTACGTTTGGTA No data
Right 1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173022597 Original CRISPR ATAAATAAACAGATGGAGCA TGG Intergenic
No off target data available for this crispr