ID: 1173026209

View in Genome Browser
Species Human (GRCh38)
Location 20:39309811-39309833
Sequence CTGAGTGATGCTAATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173026207_1173026209 -3 Left 1173026207 20:39309791-39309813 CCTGCATTTCTAATGAGTTCCTG No data
Right 1173026209 20:39309811-39309833 CTGAGTGATGCTAATGCTGCTGG No data
1173026206_1173026209 5 Left 1173026206 20:39309783-39309805 CCAGAGAACCTGCATTTCTAATG No data
Right 1173026209 20:39309811-39309833 CTGAGTGATGCTAATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173026209 Original CRISPR CTGAGTGATGCTAATGCTGC TGG Intergenic
No off target data available for this crispr