ID: 1173029117

View in Genome Browser
Species Human (GRCh38)
Location 20:39338430-39338452
Sequence CTGTCATTGAACTTGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173029117_1173029123 24 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029123 20:39338477-39338499 GAAGGACTGAGGCTCTGAGATGG No data
1173029117_1173029127 30 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029127 20:39338483-39338505 CTGAGGCTCTGAGATGGGGTGGG No data
1173029117_1173029121 13 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029121 20:39338466-39338488 GACCTGATGGAGAAGGACTGAGG No data
1173029117_1173029119 0 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029119 20:39338453-39338475 CCTTAACAATGATGACCTGATGG No data
1173029117_1173029126 29 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029126 20:39338482-39338504 ACTGAGGCTCTGAGATGGGGTGG No data
1173029117_1173029120 6 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029120 20:39338459-39338481 CAATGATGACCTGATGGAGAAGG No data
1173029117_1173029125 26 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029125 20:39338479-39338501 AGGACTGAGGCTCTGAGATGGGG No data
1173029117_1173029124 25 Left 1173029117 20:39338430-39338452 CCAGGACACAAGTTCAATGACAG No data
Right 1173029124 20:39338478-39338500 AAGGACTGAGGCTCTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173029117 Original CRISPR CTGTCATTGAACTTGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr